A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

CAPITULO 2 CAPITULO 2 ENVELHECIMENTO CELULAR Ivana Cruz, UFSM -2010.

Apresentações semelhantes


Apresentação em tema: "CAPITULO 2 CAPITULO 2 ENVELHECIMENTO CELULAR Ivana Cruz, UFSM -2010."— Transcrição da apresentação:

1 CAPITULO 2 CAPITULO 2 ENVELHECIMENTO CELULAR Ivana Cruz, UFSM -2010

2 ORGANIZAÇÃO DOS SERES VIVOS MULTICELULARES

3 O envelhecimento é uma etapa do desenvolvimento

4 O envelhecimento altera a composição corporal 20% Água extra-celular 20% 42% Água intra-celular 33% 6% 5% 17% 12% Tecidos Ossos 15% Gordura 30% 25 anos 75 anos Goldman,1970

5 O envelhecimento induz alterações anatômicas nos órgãos

6 O envelhecimento induz alterações fisiológicas

7 Como estas alterações corporais ocorrem ao longo do envelhecimento? Alterações graduais, cumulativas e disfuncionais que ocorrem através da cascata organizacional do organismo

8 O envelhecimento e: O padrão de auto-organização dos seres vivos As macromoléculas que compõe o organismo: Proteínas Carboidratos Lipídios Ácidos Nucleícos (DNA) E a estrutura celular: Membrana plasmática Citosol e Citoesqueleto Organelas E o metabolismo energético celular: Produção de energia e calor Metabolismo oxidativo E o metabolismo ciclo celular

9 Padrão de Organização dos Seres Vivos Auto-criação (autopoiése) Reprodução Manutenção da constância do ambiente interno (homeostase)

10 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Proteínas Unidade fudamental: Aminoácidos Cadeia de aminoácidos Alimentos Molécula fundamental na estrutura celular do ser vivo

11 Auto-criação Diferenciação/regeneração/cicatrização

12 Reprodução

13 Homeostase

14 Envelhecimento biológico: movimento contrário a auto-organização Auto-criação: - Diminui a taxa de divisão celular - Diminui as taxas de regeneração e cicatrização Reprodução: - Diminui as taxas reprodutivas Homem: processo gradual Mulher: processo abrupto (menopausa) Homeostase: - Tende a alterar a constância do meio interno levando a um declínio fisiológico acentuado na maior parte dos órgãos

15 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Carboidratos Glicose UNIDADE Alimentos -Produção de energia: glicose -Armazenamento de energia: Glicose- Sangue Glicogênio – Músculos Fígado Fonte carboidratos (glicose): -Dieta -Produzida pelo organismo

16 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Lipídios Principais moléculas Ácidos graxos -Triglicerídeos -Colesterol Moléculas mais heterogêneas Participam: - Membrana Plasmática - A partir do colesterol são sintetizados todos os hormônios esteróides do corpo como o estrogênio, testosterona, vitamina D, etc.

17 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Proteínas Peso corporal: 70-75% Água 20-25% Proteínas Moléculas fundamentais na: - Estrutura corporal - No metabolismo: - Enzimas - Receptores proteícos

18 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Proteínas 20 AMINOÁCIDOS AMINOÁCIDOS ESSENCIAIS: não sintetizamos arginina, fenilalanina, isoleucina, leucina, lisina, metionina, serina, treonina, triptofano, histidina e valina AMINOÁCIDOS NÃO-ESSENCIAIS alanina, asparagina, cisteína, glicina, glutamina, prolina, tirosina, ácido aspártico, ácido glutâmico

19 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Ácidos Nucleícos: DNA & RNAs

20 CÉLULAS E METABOLISMO: Uma revisão/atualização

21 Membrana Celular

22 Membrana Celular: funções - Delimitação (isolamento físico) da célula em relação ao ambiente que a rodeia; -Regulação das trocas químicas ou físicas entre o interior da célula e o ambiente externos; -Comunicação entre as células e o seu meio ambiente; -Suporte estrutural para que as células formem os tecidos corporais existindo proteínas transmembrana que se ligam na parte interna (citoplasma) atravessam a bicamada lipídica e se ligam a outras proteínas presentes no ambiente extracelular. -Delimitação de ambientes específicos intracelulares que possuem funções diferenciadas. Estes ambientes físicos delimitados por membranas são genericamente conhecidos como organelas.

23 Membrana Celular

24 Membrana celular: estrutura

25 Membrana celular: proteínas

26

27

28

29

30

31

32

33 Membrana: comunicação célula- célula Fonte: Silverthorn, Existem dois tipos de sinais: químicos ou elétricos -Existem três processos de comunicação: (1) transferência citoplasmática de sinais junções comunicantes químicos/elétricos via junções comunicantes (2) comunicação local de substâncias que se difundem através do líquido extracelular se difundem através do líquido extracelular (3) comunicação a longa distância: hormônios

34 Membrana: comunicação célula- célula

35

36

37

38

39 CITOSOL E ORGANELAS

40 PRINCIPAIS FUNÇÕES DO CITOESQUELETO Determina a forma das células Estabiliza a posição das organelas dentro do citoplasma Auxilia no transporte de moléculas para dentro e para fora da célula Auxilia na manutenção da célula em um local do tecido Permite o movimento de algumas células através do corpo

41 CITOSOL E ORGANELAS

42

43

44

45

46

47 MATRIZ EXTRACELULAR Material sintetizado que e secretado pelas células de um tecido A quantidade de matriz extracelular As moléculas que compõe a matriz extracelular Serve como sustentação do tecido e atua na manutenção da homeostase corporal Altamente variáveis e dependente do tipo de tecido

48 Célula Núcleo Como ocorre o desenvolvimento corporal e a manutenção da homeostase se todas as células contém o mesmo DNA?

49 DOGMA GENE-PROTEÍNA 3TAAGCAATCTCTGGTAAGCTA5 5ATTCGTTAGAGACCATTGGAT3 Núcleo 5ATTCGTTAGAGACCATTGGAT3 DNA RNA 5ATTCGTTAGAGACCATTGGAT3 Proteínas Célula

50 ESTRUTURA DO GENE EUCARIÓTICO

51 Região Promotora Estradiol Modulação da Expressão do gene Testosterona Inibição/ Estimulação

52 REGULAÇÃO DA EXPRESSÃO GÊNICA Região Promotora Modulação da Expressão do gene Inibição/ Estimulação Resveratrol DIETA BENEFÍCIO A SAÚDE

53 Regulação Gênica Muitos processos biológicos ocorrem em todas as células portanto a síntese de muitas proteínas é igual PROTEÍNAS Algumas PROTEÍNAS são abundantes em tipos Especializados de células apesar dos seus TODAS AS CÉLULAS Genes estarem em TODAS AS CÉLULAS

54 Regulação Gênica Estudos sugerem que uma célula eucariótica Expressa aproximadamente mil genes dos 30 mil genes que possui.

55 Regulação Gênica A expressão de um gene é CONTROLADA DNA Rna heterogêneo mRNA Proteína Modificações pós-síntese Controle transcricional Controle splicing (processamento) Controle traducional Controle pós-síntese

56 Regulação Gênica A expressão de um gene é CONTROLADA DNA Rna heterogêneo mRNA Proteína Modificações pós-síntese Controle transcricional Controle splicing (processamento) Controle traducional Controle pós-síntese

57 Regulação Gênica A regulação da expressão dos genes pode ser ALTERADA em resposta a uma influência ambiental como por exemplo: - Desnutrição - Desidratação - Temperatura extremas - Hormônios exógenos Ou genética: - Mutações genéticas - Teratógenos (compostos fatores que induzem a mal-formações genéticas

58 Regulação Gênica

59 Metabolismo Energético da Célula e Controle de Radicais Livres

60 Metabolismo Energético e Radicais Livres Glicose + Oxigênio Transportadas para a Mitocôndria Ciclos Bioquímicos Energia + Calor ~ 5% Superóxido O -2 Sistema Antioxidante Enzimático Superoxido_____H2O2 __CAT __ Água GPX Não-enzimático Dieta (Frutas/Verduras)

61 Ação do Envelhecimento: Estresse Oxidativo Glicose + Oxigênio Transportadas para a Mitocôndria Ciclos Bioquímicos Energia + Calor ~ 5% Superóxido O -2 Sistema Antioxidante Enzimático Superoxido_____H2O2 __CAT __ Água GPX Não-enzimático Dieta (Frutas/Verduras)

62 Ação do Envelhecimento: Estresse Oxidativo Superóxido H202 H2O2 + Metais = OH RADICAIS LIVRES Moléculas Altamente Reativas Agem: Proteínas Carboidratos-Lipidios Acidos Nucleicos Membranas celulares Produção de produtos metabólicos Associados a muitos processos do Envelhecimento e a + de 200 doenças crônicas

63 Os radicais livres são sempre inimigos? Não! -Utilizados em rotas metabólicas para produção de moléculas importantes do organismo. Ex. Produção do óxido nitrico -Moléculas fundamentais para o sistema imune inato que combate microorganismos

64 Quem é o inimigo? O DESBALANÇO ENTRE A GERAÇÃO DOS RADICAIS LIVRES E O SEU CONTROLE PELOS SISTEMAS ANTIOXIDANTES Aumento de radicais livres – Morbidade Mortalidade Diminuição acentuada de radicais livres- Morbidade Mortalidade

65 -Alteração da taxa de síntese das proteínas -Alteração da taxa de síntese/degradação das proteínas -Alteração na degradação e limpeza dos detritos proteícos -Alteração nas estruturas das macromoléculas: - Carbonilação de proteínas - Peroxidação de lipídios -Diminuição na maquinaria de reparo do DNA aumento -A taxa de mutações no DNA o que irá alterar a expressão dos genes. -Alteração na estrutura do cromossomo o que também pode -Alterar a expressão dos genes Macromoléculas e Envelhecimento

66

67 Proteínas - Sintetizadas Degradadas Turnover Libera aminoácidos Re-utilizados Lisossomos Resíduos Proteícos Exocitose Eliminados Sistema Urinário Digestão Aminoácidos Ambiente Externo Ambiente Externo Organismo Células

68 Macromoléculas e Envelhecimento Proteínas - Sintetizadas Degradadas Turnover Libera aminoácidos Re-utilizados Lisossomos ACÚMULO Resíduos Proteícos Exocitose Eliminados Sistema Urinário Digestão Aminoácidos Ambiente Externo Ambiente Externo Organismo Células OXIDAÇÃO

69 Macromoléculas e Envelhecimento


Carregar ppt "CAPITULO 2 CAPITULO 2 ENVELHECIMENTO CELULAR Ivana Cruz, UFSM -2010."

Apresentações semelhantes


Anúncios Google