A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Biologia Molecular Básica e Aplicada Primeira Oficina de Trabalho das Redes Nacionais de Laboratórios Dra. Maria Inês de Moura Campos Pardini Pesquisadora.

Apresentações semelhantes


Apresentação em tema: "Biologia Molecular Básica e Aplicada Primeira Oficina de Trabalho das Redes Nacionais de Laboratórios Dra. Maria Inês de Moura Campos Pardini Pesquisadora."— Transcrição da apresentação:

1

2 Biologia Molecular Básica e Aplicada Primeira Oficina de Trabalho das Redes Nacionais de Laboratórios Dra. Maria Inês de Moura Campos Pardini Pesquisadora do Depto. de Clínica Médica da FMB Responsável pelo Lab. de Biologia Molecular do Hemocentro-Botucatu Biologia Molecular Básica e Aplicada Primeira Oficina de Trabalho das Redes Nacionais de Laboratórios Dra. Maria Inês de Moura Campos Pardini Pesquisadora do Depto. de Clínica Médica da FMB Responsável pelo Lab. de Biologia Molecular do Hemocentro-Botucatu

3 H A* T* C* G*

4 CTGACTTCGACAAGACTAAA GAC TGAAG C* TGAAGCTGTTCT G* TG A* TGAAGCTGTTCTGATT T* T* TGAAGCTGTTCT G* CTGACTTCGACAAGACTAAA GAC

5 TGAAG C* GAC TGAAGCTGTTCT G* GAC TG A* GAC TGAAGCTGTTCTGATT T* GAC T* TGAAGCTGTTAT G* GAC TGAAGCTGTT A* GAC TGAAG C* GAC T* GAC T* GAC TGAAG C* GAC T* GAC TGAAGC T* GAC TGAAGC T* GAC TGAAGCTGTTCTGATT T* GAC TGAAGCTGTTCTGATT T* GAC TGAAG C*

6

7

8

9

10

11

12

13

14 DNA Fita Simples Fragmentos maiores Fragmentos menores 3 5 Eletroforese Complementaridade de Cadeias

15

16

17

18 A DETECÇÃO DE MUTAÇÕES NO GENÓTIPO VIRAL GENOTIPAGEM A DETECÇÃO DE MUTAÇÕES NO GENÓTIPO VIRAL GENOTIPAGEM

19

20 Genes Estruturais Genes Regulatórios Genes Estruturais Genes Regulatórios

21 HETERODÍMERO P aa P aa

22

23 RNA cDNA DNA

24 Asp – Thr - Gly

25

26 TRATAMENTO INIBIDORES DA TRANSCRIPTASE REVERSA FASES PRECOCES INIBIDORES DA PROTEASE FASES TARDIAS INIBIDORES DA PROTEASE

27 VÍRUS SELVAGEM (WILD TYPE) VÍRUS MUTANTE MUTAÇÕES SILENCIOSAS ALTERAÇÕES DE AA

28

29 RESISTÊNCIA FENOTIPAGEM GENOTIPAGEM

30 INTPRTR

31 Extração de RNA RT- PCR Extração de DNA PCR

32 DNA genômico Taq polimerase Primers Tampão dCTP dATP dGTP dTTP 94ºC 72ºC 57ºC

33 PRODUTO DA PCR NESTED PCR PR NESTED PCR TR

34

35 Descrita por Sanger et al em 1977 nucleotídeo análogo PCR Dideoxinucleotídeo

36

37

38

39

40 SEQUENCIAMENTO AUTOMÁTICO

41

42

43

44

45

46 Arte gráfica: Adriana, Rejane, minhas alunas.

47


Carregar ppt "Biologia Molecular Básica e Aplicada Primeira Oficina de Trabalho das Redes Nacionais de Laboratórios Dra. Maria Inês de Moura Campos Pardini Pesquisadora."

Apresentações semelhantes


Anúncios Google