A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

O conceito de informação em biomol Prof. Dr. Francisco Prosdocimi.

Apresentações semelhantes


Apresentação em tema: "O conceito de informação em biomol Prof. Dr. Francisco Prosdocimi."— Transcrição da apresentação:

1 O conceito de informação em biomol Prof. Dr. Francisco Prosdocimi

2 Os gregos Caos X Cosmos – Cosmos = informação Ordem no universo pode ser descrita e estudada – A origem das ciências – O sol nasce todos os dias Gregos eram teóricos

3 Informação O universo possui regras A ciência consiste na descoberta e descrição dessas regras Isaac Newton (1687) – Gravidade, aceleração, distância, tempo O universo era finalmente explicado Mas... E a biologia?

4 A hereditariedade Cadelas dão a luz a cachorrinhos Filhos se parecem com os pais – Por que? – Como isso acontece? O estudo da genética (a partir de 1900)

5 2000 anos de hereditariedade Dos gregos ao século XVIII – Preformacionistas X Epigeneticistas – Naturalistas: filhos têm características de ambos os pais 1839; Schwann and Schleiden – Célula como unidade básica da vida – Fertilização Fim do século XIX – Conhecimento sobre a divisão celular – Herança por mistura

6 Lamarck e Darwin Uma teoria evolutiva bem fundamentada precisa conter uma teoria da hereditariedade – Em que tipo de informação consiste a hereditariedade? – Como ela é transmitida? Philosophie zoologique (1809) – Herança dos caracteres adquiridos – Informação biológica adquirida é herdada (hardwired) A origem das espécies (1859) – Darwin era lamarckista? August Weismann (1888) – Teoria do germoplasma e Weismann

7 Mendel A Hereditariedade particulada (gene) – Refutou a herança por mistura Publicou Experimentos sobre a hibridi- zação de plantas em 1865 e – foi citado apenas 3 vezes nos 35 anos que se seguiram! Início do Século XX Bateson, De Vries e Correns Gregor Mendel ( )

8 O que é a vida? Fim do século XIX – A morte do vitalismo Schrodinger, 1944: Whats life? – Pag. 1: "how can the events in space and time which take place within the spatial boundary of a living organism [cell] be accounted for by physics and chemistry? O gene como uma molécula! – Cristal aperiódico (carregador de informação) – Watson diz achar a idéia maravilhosa Erwin Schrodinger ( )

9 Estrutura cristalina Conjunto de átomos arranjados de uma forma particular – Apresenta ordem e simetria A ordem é repetida tridimensionalmente, formando um arranjo químico ordenado e repetitivo Schrodinger: DNA como cristal aperiódico – Deve carregar informação

10 Analógico X Digital

11 Informação digital é medida em bits

12 Mudança de base numérica Números podem ser representados em quaisquer base numérica O sistema decimal Sistema binário Mudança para a base 5

13 O DNA como um código digital A, C, G e T – Pode ser representado como número em base 4 0, 1, 2 e 3 – Representação binária do DNA: 00, 01, 10, 11 1 byte são 8 bits – Armazena 4 bases consecutivas – 3,100,000,000 bases (genoma humano) = 775,000,000 bytes = 775 Megabytes Windows XP = 1,5Gb Código digital de quatro algarismos – Guarda a informação sobre como fazer outro indivíduo daquela espécie Como um código digital pode estar codificado quimicamente?

14 Watson & Crick 1952: primeiro encontro de Watson e Crick – Desde o dia de nosso primeiro encontro, Crick e eu pensamos que seria altamente provável que a informação genética do DNA fosse codificada pela seqüência de quatro bases Construção de um modelo molecular que permitisse: – Estabilidade estrutural – Mecanismo de cópia – Armazenamento de informação A biologia finalmente tinha um modelo digital para a transferência da informação hereditária Agora seria possível estudar a biologia de maneira precisa, matemática, estatísticas – Era possível aplicar o rigor das ciências exatas ao mundo natural

15 O modelo do DNA > Meu gene GGCTGCGGAGGACCGACCGTCCCCACGCCTGCCGCCCCGCGACCCCGACCGCCAGCATG GCTCCTGGCCTATTACTTCACGGAGCTGAAGGATGACCAGGTCAAAAAGATTGACAAGT ATGCGGCTCTCCGATGAAACTCTCATAGATATCATGACTCGCTTCAGGAAGGAGATGAA CCCGGGATTTTAATCCAACAGCCACAGTCAAGATGTTGCCAACATTCGTAAGGTCCATT TGAAAAGGGAGATTTCATTGCCCTGGATCTTGGTGGGTCTTCCTTTCGAATTCTGCGGG Qual fita representamos na bioinformática?

16 O leitor da Informação Trouxe a informação de facto para o centro da discussão – Propôs formas de ler e apresentar a informação biológica Publica, em 1952, a primeira estrutura primária de uma proteína (insulina) – Prova que as proteínas poderiam ser descritas como cadeias de aminoácidos – 1958: ganha o Nobel em química 1975: inventa o método dideóxi para o sequenciamento do DNA 1977: sequencia, pela primeira vez, o genoma inteiro de um organismo, o bacteriófago phi X 174 – 11 genes in 5386 bases sequenciadas à mão – Ganha o segundo Nobel de química em 1980 Frederick Sanger 13 August 1918

17 A hereditariedade compreendida O código molecular da hereditariedade está escrito em letras químicas – 4 letras: A, C, G e T – (da mesma forma que o código do português está escrito em 23 letras + espaço) – (e o código do computador, em duas letras – 0 e 1)

18 O DNA como a receita da vida Repositório inalterável da informação evolutiva hereditária Quando faz-se um bolo, mexe-se na receita?

19 A biologia molecular enquanto cibernética Cibernética Origem: Wikipédia, a enciclopédia livre. Cibernética é uma tentativa de compreender a comunicação e o controle de máquinas, seres vivos e grupos sociais através de analogias com as máquinas cibernéticas (homeostatos, servomecanismos, etc.).comunicaçãoservomecanismos A Cibernética estuda o tratamento da informação no interior de processos cibernéticos como codificação e descodificação, retroação ou realimentação (feedback), aprendizagem, etc. informaçãocodificação descodificaçãorealimentaçãofeedback Segundo Wiener (1968), do ponto de vista da transmissão da informação, a distinção entre máquinas e seres vivos, humanos ou não, é mera questão de semântica. Cyborg = cybernetic organism

20 O gene egoísta, 1976 Richard Dawkins Organismos biológicos como máquinas de sobrevivência para os genes – Apenas os melhores genes, capazes de construir uma máquina de sobrevivência para propagar sua informação de forma eficiente, ganharão a corrida evolutiva A origem da vida através da molécula replicadora Alto conteúdo empírico: explica o instinto sexual, cuidado parental, nepotismo, diferenças comportamentais entre machos e fêmeas (teoria do investimento parental), Baseados na concepção do gene como unidade de informação que quer se manter viva ao longo das eras

21 Conclusão A compreensão do código informacional para a hereditariedade foi um processo lento de conhecimento sobre as regularidades que regem o processo O DNA contém as informações sobre a hereditariedade – Essas informações estão impressas em um código digital A sequência de bases químicas em um genoma (DNA) não é disposta ao acaso e guarda a informação sobre como fazer um determinado indivíduo daquela espécie Toda a vida consiste na reprodução de moléculas replicantes com conteúdos informacionais


Carregar ppt "O conceito de informação em biomol Prof. Dr. Francisco Prosdocimi."

Apresentações semelhantes


Anúncios Google