A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Transcrição & Processamento RNA: eficiente & eficaz.

Apresentações semelhantes


Apresentação em tema: "Transcrição & Processamento RNA: eficiente & eficaz."— Transcrição da apresentação:

1 Transcrição & Processamento RNA: eficiente & eficaz

2 Dogma Central da Biologia Molecular

3 TRANSCRIÇÃO Processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na seqüência de nucleotídeos de uma molécula de DNA fita dupla. A transcrição representa a diversidade e a complexidade da expressão dos genes contidos em um determinado genoma. Enquanto a síntese de DNA deve ser precisa e uniforme, a transcrição reflete o estado fisiológico da célula e, portanto, é extremamente variável para atender às suas necessidades.

4 TRANSCRIÇÃO Características Gerais: Complementaridade Antiparalelismo ( T = U) Síntese 5' 3 RNA Polimerase (RNAP): Funções reconhecem e ligam-se desnaturam DNA mantém estável a dupla fita aberta mantém estável DNA:RNA terminam síntese restauram DNA

5 TRANSCRIÇÃO Apenas uma das fitas do DNA é utilizada como molde, portanto, a molécula de RNA sintetizada é complementar à fita de DNA que lhe deu origem e idêntica à outra fita de DNA, sendo as timinas substituídas por uracilas Em 1960, Hurwitz, Stevens e Weiss descobriram, independentemente, uma enzima capaz de sintetizar RNA na presença de DNA fita dupla e dos nucleotídeos A, U, C, G. Esta enzima foi denominada RNA polimerase.

6 RNA POLIMERASE Reconhece e liga-se a seqüências específicas de DNA; Desnatura o DNA expondo a seqüência de nucleotídeos a ser copiada; Mantém as fitas de DNA separadas na região de síntese; Renatura o DNA na região imediatamente posterior à da síntese; Sozinha, ou com o auxílio de proteínas específicas, termina a síntese do RNA.

7 RNA POLIMERASE Em eucariotos existem vários subtipos de RNA polimerases envolvidas na síntese de RNAs específicos:. RNA polimerase I – localizada no nucléolo e responsável pela síntese do RNA ribossômico. RNA polimerase II – localizada no nucleoplasma e responsável pela síntese do RNA mensageiro. RNA polimerase III – também localizada no nucleoplasma e responsável pela síntese do RNA transportador

8 TRANSCRIÇÃO Reação ocorre entre o radical hidroxil da extremidade 3 de um ribonucleotídeo e o grupo fosfato do carbono 5 do ribonucleotídeo a ser incorporado A reação processa-se no sentido 5 3 e a fita de DNA copiada é a de sentido 3 5 Diferentemente da DNA polimerase, a RNA polimerase não necessita de um iniciador para processar a síntese da nova fita

9 TRANSCRIÇÃO 1.INÍCIO Reconhecimento de seqüências específicas no DNA 2. ALONGAMENTO Incorporação dos ribonucleotídeos 3. TERMINAÇÃO Seqüências no DNA são reconhecidas e a síntese é interrompida

10 INÍCIO DA TRANSCRIÇÃO O DNA apresenta seqüências específicas, denominadas PROMOTORES, que sinalizam exatamente onde a síntese do RNA deve ser iniciada. Os promotores são, primeiramente, reconhecidos por fatores de transcrição que, ligados ao DNA, interagem com outros fatores, formando um complexo ao qual a RNA polimerase se associa.

11 INÍCIO DA TRANSCRIÇÃO As seqüências reguladoras da transcrição podem ser divididas em:. elementos promotores: seqüências de 100 a 200 nucleotídeos próximos ao sítio de início da transcrição que possuem seqüências consenso TATA denominadas TATA box. elementos enhancer ou amplificadores: seqüências pequenas de DNA que podem ocorrer na região 5 do gene. Ativam a expressão do mesmo.

12 Amplificam o sinal 100 vezes e os fatores de transcrição que se ligam a eles são chamados ativadores

13 As fitas do DNA se separam 10 bases upstream ao sítio de iniciação, mais especificamente no TATA box. A fita molde fica exposta e, desta forma, a síntese da cadeia complementar de RNA pode ser iniciada. INÍCIO DA TRANSCRIÇÃO

14 ALONGAMENTO DA CADEIA A polimerase desliza ao longo da fita molde extendendo um cadeia de RNA crescente no sentido 5 3 através da adição de ribonucleotídeos. Este processo ocorre até a RNA polimerase encontrar uma seqüência específica no DNA que determina o término do alongamento.

15 TÉRMINO DA TRANSCRIÇÃO Quando a RNA polimerase encontra o sítio de terminação na fita molde, ela se desliga do DNA juntamente com a nova cadeia de RNA sintetizada devido à uma desestabilização do complexo de transcrição O desligamento do RNA do sistema provoca a ruptura do complexo de transcrição e as fitas do DNA são renaturadas

16

17 O PROCESSAMENTO DO RNA Os diferentes RNAs sintetizados no processo de transcrição são chamados de transcritos primários; Na maioria das vezes, esses transcritos não representam a molécula madura, ou seja, aquela cuja seqüência e estrutura correspondem à forma final do RNA funcional; Esses transcritos necessitam sofrer modificações que fazem parte do processamento do RNA.

18 PROCESSAMENTO DO mRNA O transcrito primário da molécula de mRNA é também conhecido como pré-mRNA Este RNA precursor é sintetizado no núcleo e sofre várias alterações transformado-se no que se chama mRNA maduro ou processado. O RNA maduro é, então, transportado ao citoplasma onde será traduzido

19 PROCESSAMENTO DO mRNA Após o início da transcrição da molécula de mRNA é adicionado um resíduo de guanina à sua extremidade 5. Este resíduo chamado cap sofre, então, metilação (adição do radical metil) na posição 7 da guanina resultando na formação do nucleotídeo 7-metilguanilato. O cap protege a extremidade 5 da ação de exonucleases e, também, é utilizado para reconhecimento, pelo ribossomo, do sítio de início do processo de síntese protéica.

20 PROCESSAMENTO DO mRNA A maioria dos mRNAs possui uma seqüência de resíduos de adenina na sua extremidade 3 que é chamada de cauda poliA e é adicionada à molécula durante a transcrição. Quando se reconhece a seqüência AAUAAA, altamente conservada e localizada 10 a 30 nucleotídeos upstream ao sítio de poliadenilação, é um sinal de que a molécula está terminando e que deve ser adicionada a cauda poliA à extremidade da mesma.

21 PROCESSAMENTO DO mRNA Após a adição do cap 5 e da cauda poliA, a molécula de pré-mRNA sofre o processo de excisão dos introns e junção dos exons, mecanismo conhecido como splicing e migra para o citoplasma da célula. ( Os introns apresentam um grau de conservação maior do que os exons além de apresentarem uma característica muito importante: Os primeiros e os últimos dois nucleotídeos da extremidade 5 e 3, GU e AG, são altamente conservados.

22 RNAm liga-se as Ribonucleoproteínas nucleares pequenas (snRNPs) Splicing mediado por spliceossomo: Utiliza ATP FUNÇÃO: ajuda a clivar no sítio de splicing remove intron une os éxons anteriores e posteriores

23 PROCESSAMENTO DO mRNA Splicing: FUNÇÃO: ajuda a clivar no sítio de splicing remove intron impede afastamento dos éxons une os éxons

24 PROCESSAMENTO DO mRNA

25 Estrutura do mRNA

26

27 PROCESSAMENTO DO mRNA Um transcrito primário pode ser processado de diferentes maneiras sendo que o que é intron para um mRNA pode ser exon para outro mRNA que provém do mesmo RNA precursor Esta diferença de processamento pode ser devida à presença de dois ou mais sítios de poliadenilação e/ou à diferença no processo de splicing do pré-mRNA

28 MOLÉCULAS DE RNA RNA mensageiro – carrega a informação copiada do DNA sob a forma de inúmeros triplets cada um especificando um aminoácido RNA transportador – decifra o código representado pelo mRNA RNA ribossômico – associa-se com uma série de proteínas para formar os ribossomos

29 TRADUÇÃO Processo que se baseia na seqüência do mRNA para determinar e unir os aminoácidos formando, assim, a proteína. Cada aminoácido é codificado na seqüência de DNA como um códon contendo uma seqüência de três nucleotídeos. Moléculas de RNA transportador transferem a informação contida no genoma à uma seqüência de aminoácidos nas proteínas.

30 RNA TRANSPORTADOR Liga-se quimicamente à um aminoácido específico, através da enzima aminoacil –tRNA sintetase, sendo chamado, desta forma, de aminoacil-tRNA; Pareia com a seqüência do codon do mRNA adicionando o aminoácido que carrega à uma cadeia de peptídeos crescente.

31 RNA TRANSPORTADOR

32 RIBOSSOMOS A eficiência da tradução se deve, principalmente, à ligação da molécula de mRNA e dos aminoacil- tRNAs ao maior complexo RNA-proteína da célula – o ribossomo – que direciona o crescimento da cadeia polipeptídica Durante a síntese protéica, o ribossomo se move ao longo da cadeia de mRNA interagindo com vários fatores protéicos e o tRNA

33 CÓDIGO GENÉTICO A relação entre a seqüência de bases no DNA e a seqüência correspondente de aminoácidos, na proteína, é chamada de código genético O código genético encontra-se na forma de triplets – os códons

34 TRADUÇÃO O codon AUG, que codifica o aminoácido metionina, age como o codon de iniciação na maioria das moléculas de mRNA. O tRNA Met reconhece codons AUG internos, não carregando nunca uma metionina formilada. Quando AUG está colocado no início este é lido como uma formil-metionina; quando está dentro da região codificadora, é lido como metionina.

35 TRADUÇÃO Durante a síntese de proteínas, os ribossomos deslocam-se ao longo do mRNA, possibilitando um pareamento entre esse e os tRNAs que carregam os diferentes aminoácidos que irão compor as proteínas Os ribossomos deslocam-se ao longo do mRNA, na direção 5 3, sintetizando a proteína no sentido amino-terminal para carboxi-terminal

36 TRADUÇÃO A terminação da síntese de proteínas ocorre pelo aparecimento de códons de terminação na molécula de mRNA O reconhecimento desses códons é realizado por proteínas e não por moléculas de tRNA, diferentemente do que ocorre nos outros códons

37 Dogma Central da biologia Molecular

38 Gene RNA polimerase hnRNA mRNA Citoplasma Transcrição Processamento Núcleo Tradução proteína

39 Transcrição: A C G T A T G C A T A C G T A C T G C A T G 53 ATAT 53 A C G U A A C G U A 5 3 RNA polimerase Molécula de RNA nascente Gene ativo

40 Tradução: Molécula de mRNA A U G G C A U G C G A C G A A U U C G G A C A C A U A Cys Met Ala 5 3 Asp Glu PheHis Direção do avanço do ribossomo Ribossomo Proteína tRNA aa livre codon Gly

41 A U G G C A U G C G A C G A A U U C G G A C A C A U A Cys Met Ala 5 3 Asp Glu PheHis Gly

42 A U G G C A U G C G A C G A A U U C G G A C A C A U A Asp Met Ala Cys 5 3 Glu PheHis Gly

43 A U G G C A U G C G A C G A A U U C G G A C A C A U A Glu Met Ala Cys Asp 5 3 Phe Gly His

44 A U G G C A U G C G A C G A A U U C G G A C A C A U A Phe Met Ala Cys Asp Glu 5 3 GlyHisIle

45 A U G G C A U G C G A C G A A U U C G G A C A C A U A Gly Met Ala Cys Asp Glu Phe 5 3 His Ile Lys

46 A U G G C A U G C G A C G A A U U C G G A C A C A U A His Met Ala Cys Asp Glu Phe Gly 5 3 Ile Lys

47 A U G G C A U G C G A C G A A U U C G G A C A C A U A Ile Met Ala Cys Asp Glu Phe Gly His 5 3 Lys

48 G C A U G C G A C G A A U U C G G A C A C A U A A A A Lys Met Ala Cys Asp Glu Phe Gly His Ile 5 3 Leu

49 U G C G A C G A A U U C G G A C A C A U A A A A U U A Leu Met Ala Cys Asp Glu Phe Gly His Ile Lys 5 3 Met

50 G A C G A A U U C G G A C A C A U A A A A U U A A U G Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu 5 3 Asn

51 G A A U U C G G A C A C A U A A A A U U A A U G A A C Asn Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met 5 3 Pro

52 U U C G G A C A C A U A A A A U U A A U G A A C C C A Pro Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn 5 3 Gln

53 G G A C A C A U A A A A U U A A U G A A C C C A C A A Gln Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro 5 3

54 C A C A U A A A A U U A A U G A A C C C A C A A U A A Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln 5 3 STOP

55 A U A A A A U U A A U G A A C C C A C A A U A A A A A Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln 5 3 STOP

56 A U A A A A U U A A U G A A C C C A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln 5 3 STOP

57 A U A A A A U U A A U G A A C C C A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met 5 3

58 A U A A A A U U A A U G A A C C C A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met 5 3 AA A A U A A A A U U A A U G A A C AA A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu CYS Asn CYS 5 3 Muda a forma e função VARIAÇÃO GENÉTICA =POLIMORFISMO

59 REPRESENTAÇÃO LINEAR A MOLÉCULA DO DNA 5ATTCGGCGCTATGCATGCTATGCG3 aa1aa2aa3aa4aa5aa6aa7aa8 PROTEÍNA - Queratina- cabelo - Albumina- sangue - Hemoglobina-sangue - Estrutura do cabelo - Proteína da cor do cabelo (Melanina)

60 VARIAÇÕES GENÉTICAS Acontecem no nosso DNA Células germinativas Passa para os filhos Células somáticas Não passa para os filhos Ex. câncer Ex. cor dos olhos

61 Lembrar...RNApolimerase É essencial na transcrição... (1ª etapa da expressão gênica) Sem a RNA polimerase não há vida!!! Sem RNA polimerase não há enzimas!!!! A inibição da RNA polimerase leva à morte do organismo...

62 Correlação Clínica Antibióticos e Toxinas que têm como alvo a RNA Polimerase: – Toxina do cogumelo Amanita phalloides ou chapéu da morte, altamente tóxico. –A toxina mais letal, -amanitina, inibe a subunidade maior da RNA polimerase II, inibindo assim a síntese de mRNA. Gastrointerites, insuficiência hepática (RNA essenciais são degradados e não são substituídos). –Ação do antibiótico Rifampicina, para TB

63 Correlação Clínica Síndrome do X frágil: uma doença da Cromatina? –Retardo mental hereditário –Inativação do gene FMR1 –Doença resulta da repetição da sequência CGC Indivíduos normais cópias Indivíduos com síndrome 200-milhares de cópias –A presença do número elevado de CGC induz a uma extensa metilação do DNA da região promotora do gene FMR1. O DNA metilado se torna inativo, de modo que o mRNA de FMR1 não é sintetizado. –A ausência deste gene leva a patologia da doença

64 Correlação Clínica Fatores Transcripcionais na Carcinogênese –P53 (proteína supressora de tumor). Uma cópia mutada desta causa a síndrome de Li-Fraumeni, uma pré- disposição ao ca de mama e a sarcoma de córtex adrenal, leucemina, etc. –Mutações representam a perda da função ou estabilidade ou capacidade de se ligar ao DNA. –A p53 inibe a transcrição de genes com sequência TATA, ligando-se ao complexo formado entre os fatores de transcrição e a sequência TATA. Paralelamente a p53 liga- se a pontos específicos de genes de reparo.

65 Correlação Clínica Auto –imunidade em doença do tecido conjuntivo: Lúpus eritematoso (splicing) Talassemia devido a defeitos na síntese de RNA mensageiro (anemia), mutações que levam à terminação prematura da síntese da beta-globina Síndrome de Cockayne, autossômica recessiva, pacientes apresentam alterações de desenvolvimento e neurológicas, deformidade faciel, etc. Morem 20 anos. Mutação afeta a transcrição de alguns genes (atividade da RNA polimeraseII).


Carregar ppt "Transcrição & Processamento RNA: eficiente & eficaz."

Apresentações semelhantes


Anúncios Google