A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Biologia Molecular DNA Alexandre S. Osório. A natureza química dos genes Histórico  Miescher (1871) – Análise química com células de pus, rins, fígado,

Apresentações semelhantes


Apresentação em tema: "Biologia Molecular DNA Alexandre S. Osório. A natureza química dos genes Histórico  Miescher (1871) – Análise química com células de pus, rins, fígado,"— Transcrição da apresentação:

1 Biologia Molecular DNA Alexandre S. Osório

2 A natureza química dos genes Histórico  Miescher (1871) – Análise química com células de pus, rins, fígado, testículos, leveduras e hemácias de aves (detecção de C, H, N, O e P) = NUCLEÍNA.  Altmann (1889) – Purificação de nucleína (caráter ácido) = Ácidos Nucléicos.  Kossel (1877) – Detecção de guanina, adenina e timina. (1893) – Identificação de timina, citosina e pentose.

3 A natureza química dos genes Histórico  Levine e Jacobs (1909) – Descoberta dos nucleotídeos e caracterização do DNA e RNA.

4 A natureza química dos genes Histórico Watson e Crick (1953) – Modelo Helicoidal do DNA.

5 Identificação do DNA como material genético Transformação bacteriana - Griffith (1928)

6 RNA

7 Transcrição & Processamento RNA: eficiente & eficaz

8 Dogma Central da Biologia Molecular

9 TRANSCRIÇÃO Processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na seqüência de nucleotídeos de uma molécula de DNA fita dupla. A transcrição representa a diversidade e a complexidade da expressão dos genes contidos em um determinado genoma. Enquanto a síntese de DNA deve ser precisa e uniforme, a transcrição reflete o estado fisiológico da célula e, portanto, é extremamente variável para atender às suas necessidades.

10 TRANSCRIÇÃO Características Gerais: Complementaridade Antiparalelismo ( T = U) Síntese 5'  3‘ RNA Polimerase (RNAP): Funções reconhecem e ligam-se desnaturam DNA mantém estável a dupla fita aberta mantém estável DNA:RNA terminam síntese restauram DNA

11 TRANSCRIÇÃO Apenas uma das fitas do DNA é utilizada como molde, portanto, a molécula de RNA sintetizada é complementar à fita de DNA que lhe deu origem e idêntica à outra fita de DNA, sendo as timinas substituídas por uracilas Em 1960, Hurwitz, Stevens e Weiss descobriram, independentemente, uma enzima capaz de sintetizar RNA na presença de DNA fita dupla e dos nucleotídeos A, U, C, G. Esta enzima foi denominada RNA polimerase.

12 RNA POLIMERASE Reconhece e liga-se a seqüências específicas de DNA; Desnatura o DNA expondo a seqüência de nucleotídeos a ser copiada; Mantém as fitas de DNA separadas na região de síntese; Renatura o DNA na região imediatamente posterior à da síntese; Sozinha, ou com o auxílio de proteínas específicas, termina a síntese do RNA.

13 RNA POLIMERASE Em eucariotos existem vários subtipos de RNA polimerases envolvidas na síntese de RNAs específicos:. RNA polimerase I – localizada no nucléolo e responsável pela síntese do RNA ribossômico. RNA polimerase II – localizada no nucleoplasma e responsável pela síntese do RNA mensageiro. RNA polimerase III – também localizada no nucleoplasma e responsável pela síntese do RNA transportador

14 TRANSCRIÇÃO 1.INÍCIO Reconhecimento de seqüências específicas no DNA 2. ALONGAMENTO Incorporação dos ribonucleotídeos 3. TERMINAÇÃO Seqüências no DNA são reconhecidas e a síntese é interrompida

15 INÍCIO DA TRANSCRIÇÃO O DNA apresenta seqüências específicas, denominadas PROMOTORES, que sinalizam exatamente onde a síntese do RNA deve ser iniciada. Os promotores são, primeiramente, reconhecidos por fatores de transcrição que, ligados ao DNA, interagem com outros fatores, formando um complexo ao qual a RNA polimerase se associa.

16

17 O PROCESSAMENTO DO RNA Os diferentes RNAs sintetizados no processo de transcrição são chamados de transcritos primários; Na maioria das vezes, esses transcritos não representam a molécula madura, ou seja, aquela cuja seqüência e estrutura correspondem à forma final do RNA funcional; Esses transcritos necessitam sofrer modificações que fazem parte do processamento do RNA.

18 PROCESSAMENTO DO mRNA O transcrito primário da molécula de mRNA é também conhecido como pré-mRNA Este RNA precursor é sintetizado no núcleo e sofre várias alterações transformado-se no que se chama mRNA maduro ou processado. O RNA maduro é, então, transportado ao citoplasma onde será traduzido

19 RNAm liga-se as Ribonucleoproteínas nucleares pequenas (snRNPs) Splicing mediado por spliciossomo: Utiliza ATP FUNÇÃO: ajuda a clivar no sítio de splicing remove intron une os éxons anteriores e posteriores

20 PROCESSAMENTO DO mRNA Splicing: FUNÇÃO: ajuda a clivar no sítio de splicing remove intron impede afastamento dos éxons une os éxons

21 PROCESSAMENTO DO mRNA

22 Estrutura do mRNA

23 PROCESSAMENTO DO mRNA Um transcrito primário pode ser processado de diferentes maneiras sendo que o que é intron para um mRNA pode ser exon para outro mRNA que provém do mesmo RNA precursor Esta diferença de processamento pode ser devida à diferença no processo de “splicing” do pré-mRNA

24 MOLÉCULAS DE RNA RNA mensageiro – carrega a informação copiada do DNA sob a forma de inúmeros “triplets” cada um especificando um aminoácido RNA transportador – decifra o código representado pelo mRNA RNA ribossômico – associa-se com uma série de proteínas para formar os ribossomos

25 TRADUÇÃO Processo que se baseia na seqüência do mRNA para determinar e unir os aminoácidos formando, assim, a proteína. Cada aminoácido é codificado na seqüência de DNA como um códon contendo uma seqüência de três nucleotídeos. Moléculas de RNA transportador transferem a informação contida no genoma à uma seqüência de aminoácidos nas proteínas.

26 RNA TRANSPORTADOR Liga-se quimicamente à um aminoácido específico, através da enzima aminoacil –tRNA sintetase, sendo chamado, desta forma, de aminoacil-tRNA; Pareia com a seqüência do codon do mRNA adicionando o aminoácido que carrega à uma cadeia de peptídeos crescente.

27 RNA TRANSPORTADOR

28 RIBOSSOMOS A eficiência da tradução se deve, principalmente, à ligação da molécula de mRNA e dos aminoacil- tRNAs ao maior complexo RNA-proteína da célula – o ribossomo – que direciona o crescimento da cadeia polipeptídica Durante a síntese protéica, o ribossomo se move ao longo da cadeia de mRNA interagindo com vários fatores protéicos e o tRNA

29 CÓDIGO GENÉTICO A relação entre a seqüência de bases no DNA e a seqüência correspondente de aminoácidos, na proteína, é chamada de código genético O código genético encontra-se na forma de triplets – os códons

30 TRADUÇÃO O codon AUG, que codifica o aminoácido metionina, age como o codon de iniciação na maioria das moléculas de mRNA. O tRNA Met reconhece codons AUG internos, não carregando nunca uma metionina formilada. Quando AUG está colocado no início este é lido como uma formil-metionina; quando está dentro da região codificadora, é lido como metionina.

31 TRADUÇÃO Durante a síntese de proteínas, os ribossomos deslocam-se ao longo do mRNA, possibilitando um pareamento entre esse e os tRNAs que carregam os diferentes aminoácidos que irão compor as proteínas

32 TRADUÇÃO A terminação da síntese de proteínas ocorre pelo aparecimento de códons de terminação na molécula de mRNA O reconhecimento desses códons é realizado por proteínas e não por moléculas de tRNA, diferentemente do que ocorre nos outros códons

33 Dogma Central da biologia Molecular

34 Gene RNA polimerase hnRNA mRNA Citoplasma Transcrição Processamento Núcleo Tradução proteína

35 Transcrição: A C G T A T G C A T A C G T A C T G C A T G 5’3’ ATAT 5’3’ A C G U A A C G U A 5’ 3’ RNA polimerase Molécula de RNA nascente Gene ativo

36 Tradução: Molécula de mRNA A U G G C A U G C G A C G A A U U C G G A C A C A U A Cys Met Ala 5’ 3’ Asp Glu PheHis Direção do avanço do ribossomo Ribossomo Proteína tRNA aa livre codon Gly

37 A U G G C A U G C G A C G A A U U C G G A C A C A U A Cys Met Ala 5’ 3’ Asp Glu PheHis Gly

38 A U G G C A U G C G A C G A A U U C G G A C A C A U A Asp Met Ala Cys 5’ 3’ Glu PheHis Gly

39 A U G G C A U G C G A C G A A U U C G G A C A C A U A Glu Met Ala Cys Asp 5’ 3’ Phe Gly His

40 A U G G C A U G C G A C G A A U U C G G A C A C A U A Phe Met Ala Cys Asp Glu 5’ 3’ GlyHisIle

41 A U G G C A U G C G A C G A A U U C G G A C A C A U A Gly Met Ala Cys Asp Glu Phe 5’ 3’ His Ile Lys

42 A U G G C A U G C G A C G A A U U C G G A C A C A U A His Met Ala Cys Asp Glu Phe Gly 5’ 3’ Ile Lys

43 A U G G C A U G C G A C G A A U U C G G A C A C A U A Ile Met Ala Cys Asp Glu Phe Gly His 5’ 3’ Lys

44 G C A U G C G A C G A A U U C G G A C A C A U A A A A Lys Met Ala Cys Asp Glu Phe Gly His Ile 5’ 3’ Leu

45 U G C G A C G A A U U C G G A C A C A U A A A A U U A Leu Met Ala Cys Asp Glu Phe Gly His Ile Lys 5’ 3’ Met

46 G A C G A A U U C G G A C A C A U A A A A U U A A U G Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu 5’ 3’ Asn

47 G A A U U C G G A C A C A U A A A A U U A A U G A A C Asn Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met 5’ 3’ Pro

48 U U C G G A C A C A U A A A A U U A A U G A A C C C A Pro Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn 5’ 3’ Gln

49 G G A C A C A U A A A A U U A A U G A A C C C A C A A Gln Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro 5’ 3’

50 C A C A U A A A A U U A A U G A A C C C A C A A U A A Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln 5’ 3’ STOP

51 A U A A A A U U A A U G A A C C C A C A A U A A A A A Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln 5’ 3’ STOP

52 A U A A A A U U A A U G A A C C C A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln 5’ 3’ STOP

53 A U A A A A U U A A U G A A C C C A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met 5’ 3’

54 A U A A A A U U A A U G A A C C C A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met 5’ 3’ AA A A U A A A A U U A A U G A A C AA A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu CYS Asn CYS 5’ 3’ Muda a forma e função VARIAÇÃO GENÉTICA =POLIMORFISMO

55 REPRESENTAÇÃO LINEAR A MOLÉCULA DO DNA 5’ATTCGGCGCTATGCATGCTATGCG3’ aa1aa2aa3aa4aa5aa6aa7aa8 PROTEÍNA - Queratina- cabelo - Albumina- sangue - Hemoglobina-sangue - Estrutura do cabelo - Proteína da cor do cabelo (Melanina)

56 VARIAÇÕES GENÉTICAS Acontecem no nosso DNA Células germinativas Passa para os filhos Células somáticas Não passa para os filhos Ex. câncer Ex. cor dos olhos

57 Lembrar...RNApolimerase É essencial na transcrição... (1ª etapa da expressão gênica) Sem a RNA polimerase não há vida!!! Sem RNA polimerase não há enzimas!!!! A inibição da RNA polimerase leva à morte do organismo...

58 Correlação Clínica Antibióticos e Toxinas que têm como alvo a RNA Polimerase: – Toxina do cogumelo Amanita phalloides ou “chapéu da morte”, altamente tóxico. –A toxina mais letal, - amanitina, inibe a subunidade maior da RNA polimerase II, inibindo assim a síntese de mRNA. Gastrointerites, insuficiência hepática (RNA essenciais são degradados e não são substituídos). –Ação do antibiótico Rifampicina, para TB


Carregar ppt "Biologia Molecular DNA Alexandre S. Osório. A natureza química dos genes Histórico  Miescher (1871) – Análise química com células de pus, rins, fígado,"

Apresentações semelhantes


Anúncios Google