A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Sequenciamento de DNA em MegaBACE DNA Analysis Systems Prof. Dr. Luciano da Silva Pinto TGTGAACACACGTGTGGATTGG...

Apresentações semelhantes


Apresentação em tema: "Sequenciamento de DNA em MegaBACE DNA Analysis Systems Prof. Dr. Luciano da Silva Pinto TGTGAACACACGTGTGGATTGG..."— Transcrição da apresentação:

1

2 Sequenciamento de DNA em MegaBACE DNA Analysis Systems Prof. Dr. Luciano da Silva Pinto TGTGAACACACGTGTGGATTGG...

3 Sequenciamento do DNA Definição Identificação da ordem exata dos pares de bases (A, T, G e C) em um segmento de DNA. Importância O conhecimento da seqüência de bases de um gene fornece importantes informações sobre sua estrutura, função e relação evolutiva com outros genes (de um mesmo organismo ou de organismos diferentes).

4

5

6

7 Análise do fluxo da informação celular pela pesquisa genômica

8 Watson & Crick Nobel 1962 Histórico – O sequenciamento de DNA no tempo

9 Frederick Sanger Prêmio Nobel de medicina e fisiologia em 1980 J. Mol. Biol. v.94, p , 1975 Walter Gilbert Prêmio Nobel de medicina e fisiologia em 1980 PNAS, vol. 74 No. 2 p , 1977

10 Seqüenciamento de DNA Projeto Genoma Humano

11 Tecnologias de sequenciamento Maxam & Gilbert, método químico Maxam & Gilbert, método químico Sanger sequencing - PNAS 74 (1977), n. 12, Sequenciador MegaBACE (1Mpb/24 horas) - Pirosequenciamento - Science 281 (1998), n. 5375, Nature 437 (2005), Sequenciador 454 (150Mpb/24 horas)

12 Método de Sanger Reação de seqüenciamento –amplificação linear Eletroforese em gel de acrilamida –em placa –capilar Leitura da seqüencia –manual –automática

13 Reação de seqüenciamento fragmento de DNA (fita simples) 1 primer DNA polimerase dNTPs ddNTPs OH H

14

15 Eletroforese em placa capilar

16 Reação de sequenciamento e marcação do DNA Radioisótopos Leitura das sequências - Manual Leitura das sequências - Automática Fluoresceínas

17 Leitura da seqüência de DNA Manual Manual G A T C

18 Automática Automática Leitura da seqüência de DNA

19 Reação de sequenciamento e leitura automatizada denaturação anelamento dos primers

20

21 TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||||||||||||||||||| ATGCTTCTGGCAGAT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTT ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT 53 ATGCTTCTGGCAGATCTGAACAGTGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATAT ATGCTTCTGGCAGATCTGAACAGTGTTACT ATGCTTCTGGCAGATCTGAACAGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATT ATGCTTCT ATGCTTCTGGCAGATCT Organizando as Seqüências de DNA

22 Exemplo de gel utilizado nos seqüenciadores de gel (ex.: 377). A diferença de tamanho permite a separação dos grupos de fragmentos, e esta distribuição normal da passagem dos fragmentos é representada pelo eletroferograma (ou cromatograma) de cada seqüência (read).

23 Generic Sequencing Instrument GCTATAGTTGATTCCT Electrical Field - + Laser

24 DYEnamic ET Terminators – Pré Mix Energy Transfer Dyes Fluorescein Donor Dye Standard Rhodamine Acceptor Dyes Fluorescein-R110-ddGTP Fluorescein-R6G-ddTTP Fluorescein-TAMRA-ddATP Fluorescein-ROX-ddCTP

25

26 Ar + Laser O CO 2 - N + N ddNTP O CO 2 - N + N O 2 - OH O ddNTP Radiationless Energy Transfer Transferência de energia aumenta a fluorescência

27 Normalized Fluorescence Emission (Excitation at 488 nm) Fluorescein-R110-ddGTP Fluorescein-R6G-ddTTP Fluorescein-TAMRA-ddATP Fluorescein-ROX-ddCTP 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% Wavelength (nm) DYEnamic ET terminator - espectro de emissão

28

29

30

31 Leitura da seqüência de DNA

32 Análise dos resultados por Bioinformática

33 Montagem Limpeza das seqüências: remoção de seqüências ribossômicas remoção de seqüências de vetor remoção da região de poliA corte por qualidade eliminação das derrapagens

34 Quebrar em pedaços aleatórios ~2000pb (shotgun) DNA genômico clonar em vetor sequenciamento reads Shotgun do genoma inteiro

35 Reconstrução do DNA original a partir do fragmentos (clusterização) reads Sequência consenso (DNA original) A reconstrução é feita a partir de sobreposição dos fragmentos

36 Quebrar em pedaços aleatoriamente desde 50Kpb até 300Kpb DNA genômico ~800 bp Quebrar em pedaços de 2000pb Clonar em BACs e sequenciar apenas as pontas de cada fragmento clonar em vetor e sequenciar os fragmentos Shotgun de pedaços do genoma

37 O programa PHRED lê o chromatograma identificando e dando uma nota para cada base que forma a sequência : Genome Research 8 (3) (1998),

38 - A identificação dos picos é feita através de uma transformada de fourier do sinal - A nota é ligada com a resolução entre os picos vizinhos e a altura do background background

39 Região de qualidade alta Picos bem definidos e grandes. Linha de base boa. Distância entre picos anterior e posterior constante. Analisando o cromatograma

40 Região de qualidade média – poucas ambigüidades Picos razoavelmente bem definidos e de tamanho médio. Linha de base boa a razoável. Distância entre picos anterior e posterior razoável.

41 Região de qualidade baixa – baixa confiabilidade Picos mal definidos e de tamanho pequeno. Linha de base confusa. Distância entre picos anterior e posterior inconstante.

42 Onde q é a nota phred e P é a probabilidade encontrar uma base errada : - Nota phred = 20 => 1 base errada a cada 100 (99%) - Nota phred = 30 => 1 base errada a cada 1000 (99.9%) - Sequenciamento produz seqüências da ordem de 500 pb

43 Pirosequenciamento Science 281 (1998), n. 5375,

44 Quebrar em pedaços aleatórios ~2000pb (shotgun) DNA genômico Ligação do adaptador e separação em fita simples Shotgun do genoma inteiro

45 - O adaptador permite que o DNA se ligue em grânulos minúsculos (diâmetro de 28 m). Apenas um DNA é ligado em cada grânulo - Os grânulos são envolvidos em gotas de óleo que contêm todos os reagentes necessários para amplificar o DNA - Cada gota contendo o grânulo é mantida isolada para evitar contaminação e consegue produzir 10 milhões de cópias numa reação de pirosequenciamento - Um pmol de DNA numa reação de pirosequenciamento produz moléculas de ATP gerando mais de 10 9 fótons, num comprimento de onda de 560 nm, e num período de 3-4 segundos. Facilmente detectado por uma câmera de CCD Nature 437 (2005), Pirosequenciamento

46 O sequenciador 454 Câmera de CCD Computador Bombeamento de fluídos Câmara de fluxo contendo as amostras e as fibras ópticas (1,6 milhões/slide) Nature 437 (2005),

47 Linearidade é mantida até homopolímeros de 8 nt Pirograma

48 São obtidas seqüências de até b

49 SANGER Pirosequenciamento Depende de clonagem em bactéria (2 semanas de trabalho) Não há clonagem Reads de ~700 bp Reads de ~100 bp Clones de fita dupla permitem seqüenciamento em ambas direções (facilita orientação e montagem) Fragmentos fita simples não permitem seqüenciamento em ambas direções Sanger vs Pirosequenciamento 25 milhões de bp em 4 horas (100x mais rápido) 1 milhão de pb em 24 horas 6 meses de sequenciamento, 24 horas por dia, para sequenciar o genoma de um fungo 24 horas para sequenciar o genoma de um fungo Conclusão : a união faz a força PNAS 103 (2006), 11240

50 Os organismos possuem padrões

51 As moléculas também.

52 Daehhhh ! Evolução Caracteres morfológicos Macadores moleculares Sequências Similaridade X Homologia A homologia deve ser uma conclusão feita pela observação da similaridade. Transferência horizontal Um alto índice de similaridade entre as sequências justifica a conclusão de que elas são homólogas ?

53 1859: Charles Darwin A Origem das Espécies : Viagem do Beagle

54 : Viagem do Sorcerer II

55 Animações eq.htmlhttp://www.dnalc.org/ddnalc/resources/sangers eq.html htmlhttp://www.dnalc.org/ddnalc/resources/cycseq. html


Carregar ppt "Sequenciamento de DNA em MegaBACE DNA Analysis Systems Prof. Dr. Luciano da Silva Pinto TGTGAACACACGTGTGGATTGG..."

Apresentações semelhantes


Anúncios Google