A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi.

Apresentações semelhantes


Apresentação em tema: "Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi."— Transcrição da apresentação:

1 Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi

2 Tradução em eukarya e prokarya Eventos pós-transcricionais

3 Processo de síntese de proteínas RNAm contém o código do gene RNAt é o adaptor que liga o mundo do ácido nucléico ao mundo das proteínas RNAr faz parte do ribossomo e contém a enzima que catalisa a ligação entre aminoácidos adjacentes

4 tRNA é o adaptador de Crick ~60-90bp

5 Transcrição e processamento do RNAt É transcrito de um gene presente no DNA... E então processado Contém o código do adaptador

6 O código genético Tradução in vitro de sequências de poli- nucleotídeos conhecidos Diferenças nas cadeias laterais dos aminoácidos – Ribozimas X Enzimas

7 O código genético é redundante Gamow: 20 aminoácidos devem ser codificados por, pelo menos 3 bases LeuProArgLisIle UUAUUACCUAUUAAACGG CUGCUGCCGAUAAAGCGA Códon: cada grupo de três nucleotídeos consecutivos

8 Open reading frame determinação da janela de leitura (ORF) Código não-sobreposto

9 As seis fases de leitura possíveis 5'3' Frame 1 gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc E V W F A T G V S G R R G - G W L S V A 5'3' Frame 2 gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc R S G L Q L G S L G G G V K G G C Q W 5'3' Frame 3 gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc G L V C N W G L W E E G L R V V V S G 3'5' Frame 1 ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc G H - Q P P L T P P P R D P S C K P D L 3'5' Frame 2 ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc A T D N H P - P L L P E T P V A N Q T 3'5' Frame 3 ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc P L T T T L N P S S Q R P Q L Q T R P

10 Pareamento códon-anticódon Pareamento de bases Watson-Crick nas duas primeiras bases do códon – 3’-5’ to 5’-3’ (pareamento anti-paralelo)

11 Bases oscilantes (wooble) A base 3’ do códon é oscilante O contato químico não é perfeito (3D)

12 Inosina, derivado de Adenina

13 tRNA contém bases modificadas Processamento do tRNA

14 Como o aminoácido correto é ligado ao tRNA? Como o tRNA correto é ligado ao aminoácido? Como o código genético funciona molecularmente

15 tRNA-aminoacil sintetases Ligam o tRNA e o aminoácido Reconhecem o anticódon e carregam o aminoácido correto

16 Aminoácidos ativados

17 Ativação do triptofano

18 Quantas tRNA-aminoacil transferases? Uma por aminoácido? – Ou uma por códon? Uma única amino acil tRNA sintetase liga um aminoácido a todos os seus tRNAs

19 Classes de tRNA aminoacil transferases

20 Controle da tradução I Afinidade da enzima pelo tRNA disposto no código – tRNA errado liga-se lentamente e desliga-se rapidamente A adição do aminoácido ao tRNA incorreto é muito lenta

21 Controle da tradução II O aminoácido deve se encaixar no sítio sintético da tRNA-aminoacil -sintetase... e não ao sítio de edição Mecanismo de peneira dupla

22 (des)Controle da tradução III Não acontece verificação do aminoácido na tradução O controle, portanto, é feito apenas no momento da aminoacilação do tRNA

23 O congelamento do código genético Conservado em praticamente todos os organismos vivos Maquinaria altamente complexa e eficiente Surgiu uma única vez e todos os organismos vivos hoje são descendentes do organismo onde o código surgiu → adaptação!

24 Ribossomos

25 Estrutura 2D e 3D do RNAr

26 Ribossomos de E. coli

27 Ribossomos eucarióticos O peso do ribossomo se deve mais ao componente de RNA do que ao componente protéico

28 Ribosomal components

29 Reciclagem ribossomal

30 Sítios ribossomais utilizados na tradução Quatro sítios: um para mRNA e três (sítio A, P e E) para tRNA

31 Prokarya X Eukarya RNA policistrônico Operon RNA monocistrônico interação entre proteínas que se ligam a cauda poliA e proteínas do Complexo de Iniciação

32 Iniciação da tradução Procariotos: Shine-delgarno (Ribosome Binding Site) Consenso de Kosak – hipótese do “scanning” pelo ribossomo – necessidade do 5’ CAP GCCRCCAUGG

33 Start codon Normalmente codifica metionina

34 Iniciação da Tradução Fatores de iniciação da tradução IF-1 e IF-3 tRNA carregado formil-metionina

35 Seleção do tRNA correto Somente se pareia o anti-códon é que... Liga-se também ao rRNA

36 Complexo de iniciação da tradução mRNA liga à subunidade menor do ribossomo tRNA contendo metionina (formilada) liga-se ao complexo Fatores de iniciação da tradução ajudam Subunidade maior reune- se ao complexo

37 Sítios peptidil e aminoacil

38 A U G U U U C U U G A C C C C U G A G G C G U U Ribossomo RNA mensageiro 5´ 3´ U A C H H -OOC – C – N - COH R N-terminal 5´ A A A H -OOC – C - NH 2 R

39 A U G U U U C U U G A C C C C U G A G G C G U U U A C A A A H -OOC-C-NH 2 R H H -OOC-C-N-COH R.. Formação da ligação peptídica

40 A U G U U U C U U G A C C C C U G A G G C G U U U A C A A A H H H -OOC - C – N – C – C – N -COH R O R G A A H -OOC – C - NH 2 R.. Translocação Requer GTP

41 A U G U U U C U U G A C C C C U G A G G C G U U A A A H H H -OOC - C – N – C – C – N-COH R O R G A A H -OOC – C - NH 2 R

42 A U G U U U C U U G A C C C C U G A G G C C A G A A A G A A H O H H H H -OOC – C – N – C – C – N – C- C –N -COH R H R O R - - -

43 Sítios peptidil e aminoacil O ribossomo possui 3 sítios onde cabem moléculas de tRNA O alongamento da tradução Proteínas são geradas do N ao C terminal

44 Ordem de ligação de aminoácidos

45 Ligação peptídica

46 Alongamento da tradução

47

48 Alongamento ainda... O alongamento continua até o aparecimento de um códon de parada (stop codon) UAA UAG UGA

49 O fator de extensão induz Duas pequenas paradas (permite que os tRNAs Incorretamente ligados saiam do ribossomo) 1.Primeira parada é o tempo necessário para a hidrólise de GTP (a hidrólise de GTP é mais Rápida por um par correto Códon-anticódon) 2. A segunda parada ocorre entre a dissociação de EF-Tu e a acomodação total do tRNA no sítio A do ribossomo

50 Terminação da Tradução Fator de terminação liga- se ao stop codon – UAA, UGA, UAG Proteína é liberada Complexo é desfeito

51 Releasing factor

52 Tradução em procariotos Tradução em eucariotos

53 Tempo de execução do processo

54 Possíveis erros no processo Erro na tradução Proteína incorretamente produzida Dano metabólico

55 Frameshift Alteração da fase de leitura (frame) – tRNAs específicos passam pelo stop- codon – 4 bases lidas como 3 Ultrapassa um códon de terminação Produção de proteínas fundidas

56 Chaperonas I Complexo protéico que auxilia na montagem da estrutura 3D de uma proteína

57 Chaperonas II

58 Modificações pós-traducionais Formação de ligações dissulfeto/dobramento Clivagem da cadeia Fosforilação Glicosilação Metilação/Acetilação Adição de âncoras lipídicas Regulação da função protéica

59 Proteína Pronta! E agora? Destinos possíveis...

60 Endereçamento de proteínas I - Co-traducional (vias de secreção): – ER – Golgi – Membrana plasmática – Meio extracelular II- pos-traducional: – núcleo – mitocôndria – cloroplasto – Lisossomos/pero xissomos Sinais de endereçamento na Proteína: 1- Seqüência sinal (16-30 aminoácidos no N-terminal) 2- Sinal de endereçamento nuclear ( 4-8 aminoácidos com carga positiva, ex.: PKKKRLV) 3- Sinal de retenção no RE (KDEL)

61 Proteínas organelares Produzidas com sinal de exportação Sinal é clivado quando a proteína alcança seu destino celular

62 Proteínas transmembrana Domínios hidrofóbicos são capazes de invadir as regiões lipídicas (também hidrofóbicas) da membrana plasmática

63 Inibidores de síntese protéica Antibióticos inibem a síntese de proteínas bacteriana Tetraciclina – Liga no RNA 16S (sub 30S) – Inibe a ligação do amino- acyl tRNA no sítio A Cloranfenicol – Liga na subunidade 50S

64 Conclusões Tradução é o processo de produção de proteínas A regulação ocorre principalmente na transcrição – Modificações pós-traducionais são importantes para regular a função protéica Diferentes tipos de RNAs e proteínas atuam no processo A tRNA aminoacil sintetase é a protéina responsável pelo código genético A última molécula a se juntar ao complexo de iniciação é a subunidade maior do ribossomo As proteínas normalmente começam com o aminoácido metionina A tradução continua até que haja um stop codon As proteínas precisam ter uma conformação 3D correta pra funcionar (chaperonas ajudam na montagem) Muitas proteínas contêm sinais de sinalização celular


Carregar ppt "Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi."

Apresentações semelhantes


Anúncios Google