A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Montagem e análise de genomas Janaina O. Melo UNIVERSIDADE FEDERAL DE VIÇOSA BIO 796 – Bioinformática.

Apresentações semelhantes


Apresentação em tema: "Montagem e análise de genomas Janaina O. Melo UNIVERSIDADE FEDERAL DE VIÇOSA BIO 796 – Bioinformática."— Transcrição da apresentação:

1 Montagem e análise de genomas Janaina O. Melo UNIVERSIDADE FEDERAL DE VIÇOSA BIO 796 – Bioinformática

2 Sequenciamento de genomas Genoma: conjunto de toda informação hereditária de um organismo codificada no DNA (ou RNA, em alguns vírus). Inclui tanto genes como seqüências não codificantes Sequenciamento de genomas: geralmente feito utilizando a estratégia de shotgun Montagem in silico das seqüências Identificação de genes, ORFs, análises filogenéticas, etc Construção de bibliotecas genômicas: Vetores que propagam grandes insertos, como BACs, por exemplo Esses insertos precisam ser fragmentados, pois os métodos de sequenciamento geram leituras de aproximadamente pb.

3 Nova fragmentação Fragmentação Cosmídeo, BAC, plasmídeo, etc. Inserção em vetores de alta capacidade plasmídeo CAATTGGG Clonagem em plasmídeos e sequenciamento actgactgactgactgactgactactgactgactgactgactgactactgactgactgactgactgactgactgact actgactgactgactgactgact Montagem dos contigs genoma

4 Montagem de contigs de seqüências (clusters) : Cluster 1 Cluster 3 Cluster 2

5 Estratégias de bioinformática para montagem (assembly) dos contigs VNTI ContigExpress (http://www.invitrogen.com/content.cfm?pageid=10209) TIGR DNAMAN SeqMan CAP3 - Web Contig Assembly Program (http://pbil.univ-lyon1.fr/cap3.php) Phred/Phrap/Consed

6 CAP3 - Web Contig Assembly Program Copiar as seqüências em formato fasta para o programa CAP3 CAP3: visualizar os contigs e as seqüências únicas, ver detalhes dos contigs e obter suas seqüências Pode-se fazer uma busca no banco de dados utilizando o BLAST

7 Phred/Phrap/Consed Pacote de programas para: Leitura de cromatogramas Atribuição de qualidade a cada base Mascaramento de vetores Montagem de seqüências Visualização e edição dos contigs

8 Phred: Programa que lê os arquivos dos cromatogramas, atribui uma base a cada pico e valores de qualidade às bases. A qualidade Phred corresponde a um inteiro entre 0 e 99 e está associada à probabilidade de erro de leitura. Uma base com qualidade 40 indica que o erro é 10 -4, ou seja 1 erro a cada bases. Desse modo, quanto maior o Phred maior a qualidade do sequenciamento.

9 Phrap: É um programa para montagem das seqüências. Gera várias informações sobre os contigs, contidas em path/edit_dir: phrap.out, *.ace and *.screen.contigs.qual files Uma quantidade enorme de seqüências podem ser manipuladas Gera dados importantes e permite a visualização gráfica por outros programas.

10 Consed: Programa para visualização e edição dos alinhamentos produzidos pelo Phrap.

11

12

13

14 Abrir o consed

15 Abrir os contigs

16

17

18 Pesquisar seqüências específicas

19 Selecionar um contig (não há diferença entre letras maiúsculas e minúsculas na busca)

20 Menu Navigate: Regiões de baixa qualidade Discrepância na qualidade das seqüências Regiões cobertas por somente uma fita Pesquisa por ORFs

21 Percorrer o alinhamento

22 Regiões de baixa qualidade

23 Busca por ORFs

24 Menu Misc: Tradução da seqüência consenso em aminoácidos

25 Qualidade de uma base

26

27 Verificação da qualidade da base QualidadeCor/significado 0 – 4Cinza escuro 5 – 9Cinza 10 – 14Cinza claro – 97Branco 99O usuário editou a base e a caracterizou com certeza absoluta 98O usuário editou a base, mas não a caracterizou com certeza absoluta

28 Visualizar o cromatograma e editar as bases

29 Obter informação do contig

30 Busca de ORFs na sequência ORF Finder: GENSCAN:

31 Obrigada!


Carregar ppt "Montagem e análise de genomas Janaina O. Melo UNIVERSIDADE FEDERAL DE VIÇOSA BIO 796 – Bioinformática."

Apresentações semelhantes


Anúncios Google