A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Introdução ao PCR Reação da Polimerase em Cadeia Outubro de 1985 (idéia em 1983) American Society of Human Genetics criado por Kary B. Mullis

Apresentações semelhantes


Apresentação em tema: "Introdução ao PCR Reação da Polimerase em Cadeia Outubro de 1985 (idéia em 1983) American Society of Human Genetics criado por Kary B. Mullis"— Transcrição da apresentação:

1 Introdução ao PCR Reação da Polimerase em Cadeia Outubro de 1985 (idéia em 1983) American Society of Human Genetics criado por Kary B. Mullis

2

3 Características do PCR Amplificação de Seqüências Processo Cíclico –15 a 40 ciclos –realizado por mudança de temperatura

4 Produção de DNA por PCR Produção de 2 a 4 g DNA em 1-3 hs específico = amplifica sequência-alvo na presença de DNA genômico sensível = detecta até apenas 1 sequência de molde flexível = muitas variações da técnica básica de PCR

5 Requerimentos Básicos do PCR 1. Molde - DNA ou RNA 2. DNA polimerase 3. dNTPs 4. Iniciadores de Oligonucleotídeos (Primers)

6 Função dos Iniciadores Primers fornecer grupo 3 OH para iniciação de síntese de DNA definir os limites do segmento de DNA-alvo a ser amplificado estabelecer especificidade

7 Função dos Primers

8 Oligos Iniciadores Primers sintetizados quimicamente tipicamente entre 15 a 25 bases define limites de alvo a amplificar –prévio conhecimento da sequência alvo –tradução reversa de uma sequência de PTN –primer de seqüências aleatórias

9 Ciclos de Temperatura no PCR Anelamento do Primer Tm Desnaturação Extensão 94 o C do Primer 72 o C

10

11 Desnaturação do DNA 94 a 100 o C desnaturar DNA alvo desnaturar produtos de ciclos prévios 4 a 10 min de desnaturação inicial duração de 30 s a 1 min

12 Anelamento do Primer 40 a 70 o C temperatura de hibridização otimização da temperatura para cada par de primer –composição = %G+C T m = (log 10 ([M Na+])) *(%GC) - 600/length –determina especificidade do produto amplificado tipicamente 30 s a 2 min

13 Anelamento do Primer %G+C T m = 81,5 o + 16,6 * (log 10 ([M Na+])) + 0,41*(%GC) - 600/comprimento –[Na] em concentração Molar {PCR usa-se KCl} –%GC em percentual –comprimento em bases Primer /length GCG - 674/length –formamida: subtrair 65*(% formamida) Primers > 10 bases em 0,05 M sal (PCR) T m = 59, *(%GC) - 675/comprimento

14 Extensão do Primer 72 o C Taq polimerase –faixa de atividade: 20 o C a 85 o C –atividade varia 100x nessa faixa Tempo de extensão varia de acordo com tamanho do produto desejado

15 Exponencialidade do PCR Caso ideal: N = N o 2 n N = número de moléculas amplificadas N o = número inicial de moléculas n = número de ciclos de amplificação

16 Amplificação Geométrica CicloNúmero Fita Duplas produzidas

17 PCR

18 Cinética do PCR Fase inicial (screening) –Primers procuram o DNA molde com sequências complementares (como sondas) –Primers em considerável excesso. Fase exponencial –acúmulo exponencial do fragmento de DNA –várias cópias das sequências alvos Fase tardia ou plateau –amplificação já é sub-ótima

19

20 Efeito Plateau Desvio do ideal teórico –reassociação do produto compete com anelamento do primer –polimerase torna-se limitante – perda de atividade –acúmulo de inibidores da polimerase (pirofosfato) –Limitação de outros componentes –Competição entre produtos –Pareamento produto x molde - amplificação não específica

21 DNA molde número de cópias tipicamente 10 5 a 10 6 moléculas-alvo Quantidade de DNA = equivalente a 3 x 10 5 cópias FONTE Genoma Haplóide (pb) Quantidade Humano 3 x g Levedura 2 x ng E.coli 4 x ng plasmídeo 3 x pg

22 DNA molde Número de cópias DNA genômico: 50 a 250 ng –1 g de DNA genômico humano = 3 X 10 5 moléculas de um gene único O mesmo número de moléculas está presente em: –10 ng de DNA genômico de levedura –1 ng de DNA genômico de E. coli –1-2 pg de plasmídeo –2 pg de bacteriofago

23 Taq DNA Polimerase Proteína de 94 kDa Temperatura ótima: 75 a 80 o C Termoestabilidade limitada Ausência de função de edição sem exonuclease 3 para 5 Concentração de enzima = 1 a 2,5 U / 100 L

24 Efeito da Temperatura na Taxa de Síntese de DNA TemperaturaTaxa de Síntese (nucleotídeos /seg) 22 o C 0,25 37 o C 1,5 55 o C o C> o C> 150

25 Estabilidade da Taq sob Altas Temperaturas TemperaturaT 1/2 (minuto) 92,5 o C ,0 o C 40 97,5 o C 5

26 Frequência de Erro de DNA Polimerases Termoestáveis EnzimaTaxa de Mutação por inserções de base Taq300 Vent (NEB) 57

27 Fatores Promotores da Fidelidade da Taq e Especificidade dos Primers baixar a concentração de dNTPs (menos 200 M) concentração de Mg ++ - inversa/

28 [Magnésio] Concentração de Mg 2+ afeta: –anelamento dos primers –temperatura de desnaturação do DNA molde e dos produtos amplificados Especifidade da reação Formação de dímeros de primers Atividade e fidelidade da enzima Usualmente – inicia com 1,5 mM

29 Considerações na Seleção de Primers Especificidade: primer deve formar duplex estável no sítio alvo específico Primer não forma duplex estável com si próprio ou com o outro primer Primer não possui sítios falsos no DNA alvo

30 Estabilidade dos Primers Comprimento - número de bases Relação GC/AT Temperatura de desnaturação T m –análises do vizinho mais próximo –energia livre de formação de duplex

31 Tm x GC%

32 Critérios para desenho de primers Composição de bases: –GC% = 40 a 60% –distribuição homogênea ao longo do primer Comprimento: –18 a 25 bases do primer complementar ao molde –Ambos primers = mesmo comprimento (até 3 bases)

33 Critérios para desenho de primers Seqüências repetidas ou auto- complementares: –Sem repetições invertidas no primer ou seqüências auto-complementares com + 3 bases seguida Complementaridade entre par de primers: –3 de primer não pode ligar a qualquer ponto do outro primer –Primers presentes em alta concentração e formação de híbridos com amplificação de dímeros de primers

34 - Temperatura de fusão: O Tm calculado dos dois membros do par de primers não deve diferir em mais que 5 o C O Tm do produto amplificado não deve diferir dos valores de Tm dos primersem mais que 10 o C. -

35 Temperatura de Separação de Duplexes de DNA T m = 81,5 + 16,6 log [Na + ] + 0,41 (%G + %C) - 0,65 (% formamida) - 675/comprimento - % erro de pareamento

36 Especificidade dos Primers Teoricamente 15 bases estabelecem especificidade 1/4 15 = 1,1 x Famílias de genes relacionados Duplicações assume toda sequência do primer envolvida seleção de sítio-alvo

37 Problemas comuns no Desenho de Primers Auto-complementariedade Complementariedade entre primers Establidade térmica excessiva

38 Auto Complementariedade Formação de alça GAACTACCACTGAAGATACTTCAGT HO TGACTTC T m = 71 o C ACTGAA

39 Auto Complementariedade Formação de alça sem problema GAACTACCTACGAAGATACTTCAGT OH Tm = 24 o C CTTC GAAG

40 Complementariedade entre Primers Formação de primer dimer 5 GAACTACCATAGACACACTGAAGG OH 5 CTTCAGGTCAAGAACTTCCTTCAGT OH OH TGACTTCCTCAAGAACTGGACTTC GAACTACCATAGACACACTGAAGG OH

41 Excesso de Estabilidade Térmica em 3OH TTTACTTAGTCGGACGCGGC OH CGCGGC OH GCGCCG Extremidade 3 crucial = preferir 3 como G ou C. Não recomendável que seja...NNGG ou...NNCC -> gerar dímeros de primers

42 A extremidade 5 não precisa ser complementar à seqüência alvo = permite adicionar seqüências com propósitos específicos na extremidade 5 - sítio para enzima de restrição, mais 3 a 4 bases adicionais - promotores para transcrição in vitro - promotores de seqüências consenso para inicío de tradução para transcrição e tradução in vitro Para o cálculo do Tm considera-se apenas a região complementar à seqüência alvo.

43 Primers com sítios para enzimas de restrição :

44 Estabilidade Interna Melhores primers possuem terminal 5 estável e terminal 3 instável –reduz pareamento falso Baixa estabilidade 3 previne a formação de DNA duplexes que podem iniciar a síntese de DNA –terminal 5 deve parear para formar duplex estável

45 Mal-pareamento pré-PCR Causas: –DNA fita simples complexo na amostra molde –mistura de reação completa incubada a temperatura com atividade da Taq Solução - Hot Start

46 Prevenção de Mis-priming PCR Convencional Mix de reação completo 20 a 25 o C Transferir para termociclador Ciclos Produto amplificado

47 PCR Hot Start Mix de reação completo 20 a 25 o C Transferir para termociclador desnaturação 100 o C manter a 80 o C Adicionar Taq polimerase Ciclos Produto amplificado

48 Enzimas para Hot-Start AmpliTaq Gold –enzima recombinante –forma inativada - ativação 10 min 94 o C Platinum Taq Polymerase –ligação com inibidor termolábil contendo anticorpo monoclonal

49

50

51

52

53

54 Parâmetros dos ciclos: 1. Temperatura e Tempo de desnaturação Falta de desnaturação da template é uma causa comum de falha na PCR Tipicamente 94 o C por 30 s Tempo de desnaturação muito longo reduz a meia vida da enzima

55 Parâmetros dos ciclos: 2. Temperatura e Tempo de anelamento Temperatura de anelamento = 5 o C abaixo do T m real dos primers Tempo de anelamento = 15 a 30 s Tempo de extensão função tamanho do AMPLICON –1 minuto é suficiente 1,2 kb –Longo reduz a meia vida da enzima

56 A Tm do produto amplificado não deve exceder ~85 o C. Temperatura de desnaturação em PCR é definida como a temperatura na qual há separação irreversível das fitas de uma população homogênea de moléculas. A temperatura de separação irreversível das fitas é vários graus acima do Tm (tipicamente, 92 o C para DNA com 50% de G+C).

57 DNA Polimerases Sintetizam uma fita nova de DNA extendendo um primer pela incorporação de NTPs na direção 5 -> 3 tendo como orientação a informação contida na fita molde (template).

58 DNA Polimerases As DNA polimerases normalmente têm também atividade exonuclease 3 -> 5 = atividade proof reading 5 -> 3 = atividade corretiva –necessidade de remoção de um segmento de DNA que está a frente da enzima

59 DNA Polimerases Termoestáveis Thermos aquaticus (Taq polymerase) –1ª descoberta e + usada –Síntese 5-> 3 / Exonuclease 5-> 3 Thermus thermophilus (rthpol) = similar à subunidade da DNA pol-III de E. coli. –rTth pol atividade de transcriptase reversa na presença de Mn 2+ DNA polimerases adicionam base a mais na 3 –> adição > [Mg2+] e de [enzima]. –A base a mais adicionada é quase sempre A

60 DNA Polimerases Termoestáveis Thermos aquaticus (Taq polymerase) Taxa de incorporação de bases erradas pode variar entre a 10 -6, dependendo das concentrações de Mg2+ e dNTPs A incorporação de base errada (mismatch) reduz a estabilidade da interação da enzima com o DNA, favorecendo a interrupção da polimerização. Baixa temperatura de extensão e elevada concentração de dNTPs favorecem a extensão de primers com pareamento imperfeito e a extensão após mismatch.

61 DNA Polimerases Termoestáveis Pyrococcus furiosus (Pfu) - com 2 subunidades codificadas por 2 genes de único operon –Forte atividade exonuclease 3->5 (atividade proof reading) Enzimas com atividade proof reading não adicionam A na extremidade 3OH, independentemente do molde

62 DNA Polimerases Termoestáveis Polimerases com função corretiva Pyrococcus furiosus (Pfu) Thermoccocus litoralis (Tli) Promega Vent DNA polymerase = Tli recombinante New England Biolabs –Atividade exonucleásica 3-> 5 –Mais termoestáveis que a Taq –Meia vida de 6,7 h a 95 o C) –Sintetizam fragmentos de até 13 kpb.

63 Variações de Taq polymerase AmpliTaq: Taq polimerase produzida em E. coli. Reprodutibilidade maior que enzima nativa [Applied Biosystems] AmpliTaq Gold: forma modificada da AmpliTaq fornecida em forma inativa. Requer aquecimento a o C por 10 min para ser ativada Stoffel fragment: forma amputada da Taq sem 289 amino ácidos terminal N, sem atividade exonuclease 5 --> 3. Cerca de 2 vezes mais termoestável que a Taq [Applied Biosystems]

64 Variações de Taq polymerase Taq 2000 : Taq recombinate altamente purificada [Stratagene] AdvanTaq: sem amino ácidos N-terminais com maior termorresistência, melhor atividade em faixa ampla de [Mg] e maior afinidade pelo molde – uso concentração de DNA alvo muita baixa [Clontech] AGSGold DNA polymerase : maior capacidade de síntese de DNA (3 vezes mais produto que a Taq) [Hybaid]

65

66 PCR de longa distância Mistura de enzimas = melhor que uma única enzima para amplificar fragmentos longos –KlenTaq / Pfu (ex.: 160:1 a 640:1) –Taq / Pfu Existem várias misturas disponíveis comercialmente Elongase (Invitrogen) Expand DNA Polymerase (Boehringer) Advantage (Clontech)

67 Modelo de funcionamento da mistura de enzimas Elongase (Invitrogen) Taq/Pfu

68


Carregar ppt "Introdução ao PCR Reação da Polimerase em Cadeia Outubro de 1985 (idéia em 1983) American Society of Human Genetics criado por Kary B. Mullis"

Apresentações semelhantes


Anúncios Google