A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Genética molecular dos sistemas eritrocitários: importância na prática clínica Lilian Castilho.

Apresentações semelhantes


Apresentação em tema: "Genética molecular dos sistemas eritrocitários: importância na prática clínica Lilian Castilho."— Transcrição da apresentação:

1 Genética molecular dos sistemas eritrocitários: importância na prática clínica Lilian Castilho

2 SC CO I GLOB GIL DO YT XG LW GE CH/RG KELL (24) LU (20) OK JMH RAPH ABO IN KN P KX H RH (48) MNS (43) CR (12) DI (21) FY LE JK Diversidade: Sistemas29 Locus 34 Antígenos239 Alelos >620 Constituídos por antígenos de grupos sanguíneos definidos por aloanticorpos Sistemas eritrocitários

3 Modelo de membrana: inserção dos antígenos de grupos sanguíneos Outside NH COOH GPI- linked COOH P1 P P k ABO Hh Lewis I GPA/GPB (MNSs) GPC/GPD (Gerbich) CD99 (Xg) CD147 (Ok) CR1 (CD35; Knops) CD239 (Lutheran, B-CAM) ICAM-4 (LW) ERMAP (Sc) CD44 (Indian) CD234 (Duffy) Band 3 (Diego) Rh Kx AQP-1 (Colton) Kidd AQP-3 (GIL) CD151 (Raph) AChE (Yt) Dombrock (ART4) DAF (CD55, Cromer) CD108 (JMH) Emm CD238 (Kell) Carbo- hydrate Type II Single- pass MultipassType I Single- pass Reid, 2004

4 Antígenos de grupos sanguíneos: produtos de genes 28/29 genes identificados 28/29 genes identificados polimorfismos de GS definidos ao nível genético polimorfismos de GS definidos ao nível genético antígenos carreados em proteínas são codificados diretamente pelos genes antígenos carreados em proteínas são codificados diretamente pelos genes antígenos carbohidratos estão sob o controle de genes que codificam glicosiltransferases antígenos carbohidratos estão sob o controle de genes que codificam glicosiltransferases análise molecular dos genes de GS pode ser útil na clínica análise molecular dos genes de GS pode ser útil na clínica entendimento das bases moleculares de GS permite explorar a função da proteína entendimento das bases moleculares de GS permite explorar a função da proteína

5 Antígenos de grupos sanguineos estão localizados em moléculas funcionais P ABO Lewis GLOB H I MNS Scianna Dombrock Gerbich Ch/Rg Cromer Knops LW Xg Duffy Lutheran Indian Raph JMH Ok a Rh Kidd Diego Colton GIL Kx Kell Yt Carboidratos Glicoproteinas de estrutura ou função desconhecida Regulação de complemento Moléculas de adesão Transporte e canais Enzimas

6 SNPs (single nucleotide polymorphisms) : maioriaSNPs (single nucleotide polymorphisms) : maioria Transcrição: GATATranscrição: GATA DeleçãoDeleção Gene, Exon, Nucleotídeo (s): ABO, MNS, Rh, Kell, Duffy, Dombrock, etc ABO, MNS, Rh, Kell, Duffy, Dombrock, etc Inserção:Inserção: Nucleotídeo (s) : Rh, Colton DuplicaçãoDuplicação Exon: Gerbich Exon: Gerbich Splicing alternativo: S-s-Splicing alternativo: S-s- Conversão gênica ou recombinaçãoConversão gênica ou recombinação MNS, Rh, Ch/Rg MNS, Rh, Ch/Rg Mecanismos moleculares que levam à diversidade dos antígenos de grupos sanguíneos

7 SNPs (mutações de ponto missenses) SNPs (mutações de ponto missenses) AAGTCAGCTGGACTTCGAAGATGTATGGAATTCTTCCTATGGTGTGAATGATTCCTTCCCA GATGGAGACTATGATCCAACCTGGAAGCAGCTGCCCCCTGCCACTCCTGTAACCTG (FY B) A (Asp) (FY B) A (Asp) (FY A) G (Gly) (FY A) G (Gly) RH: C/c; E/eRH: C/c; E/e MNS: S/sMNS: S/s Kell: K/k, Kp a /Kp b, Js a /Js bKell: K/k, Kp a /Kp b, Js a /Js b Diego: Di a /Di bDiego: Di a /Di b Duffy: Fy a /Fy b Duffy: Fy a /Fy b Kidd: Jk a /Jk b Kidd: Jk a /Jk b Lutheran: Lu a /Lu b Lutheran: Lu a /Lu b Dombrock: Do a /Do b Dombrock: Do a /Do b

8 Transcrição 1 TATC 2 1 TACC 2 FY A/FY B FY B FY Normal FY Mutado* Mutações no gen promotor que afetam a expressão do antígeno na hemácia GATA box * Fenótipo Fy(a-b-)

9 Rearranjos gênicos DANIELS, RHCE 10 RHD SMP1 RHCE SMP1 Rhesus box Rhesus box

10 Métodos de análise de DNA Amplificação do DNA por PCR Amplificação do DNA por PCR –PCR-RFLP –PCR-alelo-especifico –PCR-multiplex Amplificação (PCR) + sonda-especifica (probe)-Real time PCRAmplificação (PCR) + sonda-especifica (probe)-Real time PCR –TaqMan –Molecular beacons Microarray – chipsMicroarray – chips

11 PCR-RFLP (Polimorfismo Duffy) TCCCCCTCAACTGAGAACTCAAGTCAGCTGGACTTCGAAGATGTATG GAATTCTTCCTATGGTGTGAATGATTCCTTCCCAGATGGAGACTATGA TCC AACCTGGAAGCAGCTGCCCCCTGCCACTCCTGTAACCTG (FY B) GATCC (ausência de sítio Ban I) (FY B) GATCC (ausência de sítio Ban I) G (FY A) GGTCC (sítio Ban I) G (FY A) GGTCC (sítio Ban I) CTGGATGACTCTGCACTGCCCTTCTTCATCCTCACCAGTGTCCTGGG TATCCTAGCTAGCAGCACTGTCCTCTTCATGCTTTTCAGACCTCTCTT CCGCTGGCAGCTCTGCCCTGGCTGGCCTGTCCTGGCACAGCTGGCT GTGGGCAGTGCCCTCTTCAGCATTGT GGTCC CGTCTTGGCCCC AGGGCTAGGTAGCACTCGCAGCTCTGCCCTGTGTAGCCTGGGCTAC TGTGTCTGGTATGGCTCAGCCTT

12 RFLP para genotipagem Duffy 306pb 210pb86pb 96pb Ban I novo sítio Ban I Ban I sítio comum FY B FY A PCR FY B/FY B FY A/FY B FY A/FY A 306pb 210pb 86pb 392 pb 96pb 100pb 200pb 300pb 400pb 100 bp

13 PCR Alelo-Especifico (AS-PCR): Ss S-específico s-específico 100 pb S+ S- s- s S+s S+ s+ 4 5 B B CI 205pb

14 PCR Multiplex: RHCE Cc e PCR Multiplex: RHCE Cc e RHD RHc RHD Ex7 RHC RHD I4 100bp RHDcc RHD RHD/RHCc RHD

15 Real Time PCR DNA fetal no Plasma materno

16 0.3 mm 4000 ENCODED BEADS Microarray – Tecnologia Chip Oligo 3 Oligo 1 Oligo 2

17 ON-CHIP ELONGATION PAIRS OF GENETIC MARKERS SIGNAL INTENSITY ASSAY IMAGE C Mismatch T C C C C T A G G T T T C C C A G G G X C C T C C C T T T A T C C G G C Match A G G A A A G G MULTIPLEXED ANALYSIS OF POLYMORPHISMS Microarray – Tecnologia Chip FY A FY B

18 ASSAY IMAGE DECODING IMAGE Microarray – Tecnologia Chip Aquisição da imagem automática

19 HEA-18 GENÓTIPO: FY, Fy-265, GATAAB, AA, AA Do-624, -793, -323, AA K BB JK AB GPBBB GPAAB LW, Co, Sc & Di AA LuAB Microarray – Tecnologia Chip

20 Fontes de DNA que podem ser utilizadas para genotipagem Sangue (Leucócitos)Sangue (Leucócitos) Células do epitélio bucalCélulas do epitélio bucal Urina (células no sedimento urinário)Urina (células no sedimento urinário) Líquido amniótico (amniócitos)Líquido amniótico (amniócitos) DNA fetal em plasma maternoDNA fetal em plasma materno

21 Genotipagem em larga escala para identificação de antígenos comuns e raros (Programa de hemácias fenotipadas) Genotipagem em larga escala para identificação de antígenos comuns e raros (Programa de hemácias fenotipadas) Produção de painéis complementares Produção de painéis complementares Zigozidade D, Fy a, Fy b : controle de qualidade de reagentes Zigozidade D, Fy a, Fy b : controle de qualidade de reagentes Determinação dos tipos de D fraco e D parcial Determinação dos tipos de D fraco e D parcial Identificação de novos alelos Identificação de novos alelos Em doadores Seleção limitada de anti-soros Seleção limitada de anti-soros Genética molecular dos sistemas eritrocitários: aplicações

22 Em pacientes Genética molecular dos sistemas eritrocitários: aplicações –Resolução de casos clínicos em situações que os testes de hemaglutinação não fornecem resultados seguros (pacientes recém-transfundidos, pacientes portadores de AHAI aloimunizados) –Resolução de discrepâncias ABO e Rh –Determinação de microquimerismo após transplante de stem cell alogênico –Identificação de fenótipos fracos e deprimidos (D fraco, e fraco) –Investigação e confirmação de fenótipos raros (DI, DO, SC, CO) –Identificação de variantes raras (D parcial + e parcial) –Identificação de novos alelos

23 Zigozidade do gene RHD paternoZigozidade do gene RHD paterno Genotipagem RHD fetalGenotipagem RHD fetal –DNA de amniócitos –DNA de origem fetal na circulação materna (usar DNA de plasma materno) Medicina materno-fetal Genética molecular dos sistemas eritrocitários: aplicações

24 Genotipagem eritrocitária na prática clínica Caso clínico 1: Paciente politransfundido aloimunizado com anti-E e provável anti-Jk b e história de transfusão recente Paciente politransfundido aloimunizado com anti-E e provável anti-Jk b e história de transfusão recente Fenotipagem: R2r, K-k+, Fy(a+b-), Jk(a-b+) Fenotipagem: R2r, K-k+, Fy(a+b-), Jk(a-b+) Teste complementar: genotipagem RH, KEL, FY e JK Teste complementar: genotipagem RH, KEL, FY e JK

25 Caso clínico 1: Genotipagem:RHD+ RHCE cc ee, K2K2, FY A/FY A, JK A/JK A Genotipagem:RHD+ RHCE cc ee, K2K2, FY A/FY A, JK A/JK A Componente selecionado para a transfusão: Componente selecionado para a transfusão: Fenótipo deduzido do genótipo: R0r, K-, Fy(b-), Jk(b-) Fenótipo deduzido do genótipo: R0r, K-, Fy(b-), Jk(b-) 100pb RHDcc 100 pb RH ee 100 pb K2K2 FY A/FY B FY A/FY A 100 pb JK A/JK B JK B/JK B JK A/JK A Genotipagem eritrocitária na prática clínica

26 Caso clínico 2: Paciente politransfundido com TDA positivo (4+) eluato e soro positivos 4+ com todas as células, história de transfusão recente e evidência clínica de diminuição da sobrevida de hemácias transfundidas Paciente politransfundido com TDA positivo (4+) eluato e soro positivos 4+ com todas as células, história de transfusão recente e evidência clínica de diminuição da sobrevida de hemácias transfundidas –Fenotipagem do paciente: ? –Genotipagem do paciente: RHD-, RHCE cc ee, K2K2, FY A/FY B, JK A/JK B, Ms/Ns RHD-, RHCE cc ee, K2K2, FY A/FY B, JK A/JK B, Ms/Ns – sorológica complementar –Análise sorológica complementar adsorções alogênicas com hemácias rr, K-, S- para retirada do autoac –Conclusão: Aloanticorpos detectados:anti-E, -K Componente selecionado para a transfusão: Fenótipo rr, K-, S- Componente selecionado para a transfusão: Fenótipo rr, K-, S- Genotipagem eritrocitária na prática clínica

27 Caso clínico 3: Paciente falciforme aloimunizado com anti-E, anti-K e anti-Jk a recebendo sangue fenótipo compatível Paciente falciforme aloimunizado com anti-E, anti-K e anti-Jk a recebendo sangue fenótipo compatível Fenotipagem do paciente: R0r, K-k+, Fy(a-b-), Jk(a-b+) Fenotipagem do paciente: R0r, K-k+, Fy(a-b-), Jk(a-b+) Genotipagem do paciente: RHD+, RHCE cc ee, K2K2, FY B/FY B (Gata mutado), JK B/JK B Genotipagem do paciente: RHD+, RHCE cc ee, K2K2, FY B/FY B (Gata mutado), JK B/JK B Conclusão: Paciente pode receber sangue Fy(b+) Conclusão: Paciente pode receber sangue Fy(b+) Componente selecionado para a transfusão: Componente selecionado para a transfusão: Fenótipo R0r, K-, Fy(a-b+), Jk(a-) Genotipagem eritrocitária na prática clínica

28 Caso clínico 4: Paciente sexo feminino, 27 anos, história de 1 transfusão anterior, nenhuma gestação ou aborto Paciente sexo feminino, 27 anos, história de 1 transfusão anterior, nenhuma gestação ou aborto Aloimunizada com anti-D Aloimunizada com anti-D Fenotipagem da paciente: D- Fenotipagem da paciente: D- Fenotipagem do doador da hemácia transfundida: D- Fenotipagem do doador da hemácia transfundida: D- Genotipagem eritrocitária na prática clínica

29 Genotipagem da paciente: RHD- Genotipagem da paciente: RHD- Genotipagem do doador: D fraco tipo 1 Genotipagem do doador: D fraco tipo 1 (RH CE) 236pb (RH D) 115pb (RH D) 115pb 245pb (RH D) 160pb (RH CE) Exon 10 50pb Intron 4 RHD+ RHD- RHDF1 Ctl 100pb Exon 6 Caso clínico 4: Genotipagem eritrocitária na prática clínica

30 Caso clínico 5: Paciente falciforme aloimunizado com anti-D e anti-K Paciente falciforme aloimunizado com anti-D e anti-K Fenotipagem do paciente: R 0 r (D fraco), K-k+ Fenotipagem do paciente: R 0 r (D fraco), K-k+ Genotipagem do paciente: RHD+, RHCE cc ee, K2K2 Genotipagem do paciente: RHD+, RHCE cc ee, K2K2 100bp RHDcc 100 pb RH ee 100 pb K2K2 Genotipagem eritrocitária na prática clínica

31 Genotipagem complementar: D parcial DAR Genotipagem complementar: D parcial DAR Componente selecionado para a transfusão: Fenótipo rr, K- Componente selecionado para a transfusão: Fenótipo rr, K- PCR DAR 262pb 234pb 45pb Genotipagem eritrocitária na prática clínica Caso clínico 5:

32 D fracos tipos 1> 4> 3> 2 mais frequentesD fracos tipos 1> 4> 3> 2 mais frequentes Anti-D IgM: pacientes; anti-D IgG:doadoresAnti-D IgM: pacientes; anti-D IgG:doadores Reatividades < 1+ com anti-D IgG na AGH podem indicar a presen ç a de DAR, DVI, DHMiReatividades < 1+ com anti-D IgG na AGH podem indicar a presen ç a de DAR, DVI, DHMi Aspectos práticos

33 Caso clínico 6: Paciente falciforme aloimunizado com anti-e like, anti-E e provável anti-D Paciente falciforme aloimunizado com anti-e like, anti-E e provável anti-D Fenotipagem do paciente: B, D+C+E-c+e+ Fenotipagem do paciente: B, D+C+E-c+e+ Sangue selecionado para a transfusão: R 2 R 2 e rr (incompatível) Sangue selecionado para a transfusão: R 2 R 2 e rr (incompatível) Genotipagem do paciente: RHD+, RHCE cc ee, Genotipagem do paciente: RHD+, RHCE cc ee, Genotipagem complementar (e-parcial): ce s (hr B -) Genotipagem complementar (e-parcial): ce s (hr B -) Genotipagem complementar (D-parcial): DIIIa Genotipagem complementar (D-parcial): DIIIa Componente selecionado para a transfusão: Fenótipo hr B -, D- Componente selecionado para a transfusão: Fenótipo hr B -, D- Genotipagem eritrocitária na prática clínica

34 Pacientes descendentes de Africanos com variantes do gene RHCE (ceMO, ceEK, ceAR, ceBI) podem desenvolver anti-e- like, incluindo anti-hr B, anti-hr s Pacientes descendentes de Africanos com variantes do gene RHCE (ceMO, ceEK, ceAR, ceBI) podem desenvolver anti-e- like, incluindo anti-hr B, anti-hr s Estes pacientes podem também desenvolver anti-D (DIIIa, DAR) Estes pacientes podem também desenvolver anti-D (DIIIa, DAR) RHD parcial RHD RHD parcial RhCe e parcial Anti-D e-parcial: -hr B /-hr s Anti-D+e-like(-hr B /-hr s ) Aspectos práticos

35 Pacientes Normal D 2 DIIIa/DAR 2 DAR 3,1 1,5 4 Castilho et al, 2004 DIIIa 130 % pacientes desenvolveram anti-D (1 DAR e 2 DIIIa/ DAR) DIIIa e DAR em pacientes com anemia falciforme Aspectos práticos

36 Caso clínico 7: Paciente falciforme aloimunizado com anti-C e anti-K Paciente falciforme aloimunizado com anti-C e anti-K Fenotipagem do paciente: R2R2, K-k+ Fenotipagem do paciente: R2R2, K-k+ Genotipagem do paciente: RHD+, RHCE cc Ee, K2K2 Genotipagem do paciente: RHD+, RHCE cc Ee, K2K2 Genotipagem complementar: VS+, Cys16 Genotipagem complementar: VS+, Cys16 Conclusão: e+ f (variante): paciente R2r Conclusão: e+ f (variante): paciente R2r Componente selecionado para a transfusão: Fenótipo R2r K- Componente selecionado para a transfusão: Fenótipo R2r K- Genotipagem eritrocitária na prática clínica

37 * Anti-soros monoclonais anti-e (MS63) anti-e (MS16, MS21) Haplótipos Ror (56) Cys 16 Trp VS+ 50 r r (2) 0 0 VS Cys16 e VS associados ao alelo Rhce em pacientes falciformes *R 2 r (2) Rodrigues & Castilho, Vox Sang.2002 Aspectos práticos

38 Caso clínico 8: Paciente talassêmico aloimunizado com anti-c, anti-K, anti-Jk a e outro aloac? Recebendo sangue fenótipo compatível Paciente talassêmico aloimunizado com anti-c, anti-K, anti-Jk a e outro aloac? Recebendo sangue fenótipo compatível Fenotipagem do paciente: R0r, K-k+, Fy(a+b-), Jk(a-b+), M+N+S+s+ Fenotipagem do paciente: R0r, K-k+, Fy(a+b-), Jk(a-b+), M+N+S+s+ Genotipagem do paciente: Genotipagem do paciente: RHD+ RHCE cc ee, K2K2, FY A/FY A, JK B/JK B, MS/Ns Genotipagem eritrocitária na prática clínica

39 Caso clínico 8: Análise molecular complementar: Análise molecular complementar: DO A/DO A DO A/DO A Análise sorológica complementar Análise sorológica complementar adsorção com hemácias R0r, K-, Fy(b-), Jk(a-), Do(b+) /eluição): anti-Do b Conclusão: Paciente portador de anti-c, -K, -Jk a, Do b Conclusão: Paciente portador de anti-c, -K, -Jk a, Do b Componente selecionado para a transfusão: Fenótipo R0r, K-, Fy(b-), Jk(a-), Do(b-) Componente selecionado para a transfusão: Fenótipo R0r, K-, Fy(b-), Jk(a-), Do(b-) DOA/A DOB/B Genotipagem eritrocitária na prática clínica

40 Identificação de anticorpos anti-DoIdentificação de anticorpos anti-Do Possibilidade de genotipar os doadores e selecionar hemácias antígeno-negativasPossibilidade de genotipar os doadores e selecionar hemácias antígeno-negativas Maior aproveitamento transfusionalMaior aproveitamento transfusional IMPORTÂNCIA CLÍNICA Aspectos práticos Genotipagem Dombrock

41 Caso clínico 9: Gestante aloimunizada (20 0 semana) Gestante aloimunizada (20 0 semana) Anticorpo identificado: Anti-D (título: 512) Anticorpo identificado: Anti-D (título: 512) Fenótipo da paciente: rr Fenótipo da paciente: rr Genotipagem eritrocitária na prática clínica Teste complementar: Zigozidade paterna, genotipagem fetal através do plasma materno Teste complementar: Zigozidade paterna, genotipagem fetal através do plasma materno

42 Zigozidade paterna Genotipagem RHD fetal Zigozidade paterna Genotipagem RHD fetal Gestação não monitorada Gestação não monitorada PCR RHD+/D- 1888pb 744pb 3100pb 397pb 564pb Ctl+ RHD- Genotipagem eritrocitária na prática clínica I4Ex10

43 Caso clínico 10: Gestante aloimunizada (12 0 semana) Gestante aloimunizada (12 0 semana) Anticorpo identificado: Anti-D (título: 512) Anticorpo identificado: Anti-D (título: 512) Fenótipo da paciente: rr Fenótipo da paciente: rr Genotipagem eritrocitária na prática clínica

44 Zigozidade paterna Genotipagem RHD fetal PCR RHD+/D+ 1888pb 744pb 3100pb 397pb RHD+ RHD- Gestação sistematicamente monitorada Gestação sistematicamente monitorada Genotipagem eritrocitária na prática clínica

45 Situações em que genótipo e fenótipo podem não corresponder Transfusões crônicas/maciçasTransfusões crônicas/maciças Alteração no gene afetando: transcrição (Fyb-); splicing (S-s-); introdução de stop codon (Fy(a-b-), Rh null ), ou mutação que afeta a estabilidade da proteina na membrana da célula (Fy x )Alteração no gene afetando: transcrição (Fyb-); splicing (S-s-); introdução de stop codon (Fy(a-b-), Rh null ), ou mutação que afeta a estabilidade da proteina na membrana da célula (Fy x ) Crossing overs e outros rearranjos gênicos (RHD/RHCE)Crossing overs e outros rearranjos gênicos (RHD/RHCE) Alteração em outro gene que está associado com a expressão do gene : RHAG Rh nullAlteração em outro gene que está associado com a expressão do gene : RHAG Rh null

46 Implementação da genotipagem para uso clínico Amostras de sangue fenotipadas devem ser analisadas por PCR em estudo cego para avaliação do métodoAmostras de sangue fenotipadas devem ser analisadas por PCR em estudo cego para avaliação do método O número de amostras usadas na validação de um teste deve incluir o máximo de variantes genéticas presentes na população para a qual o teste vai ser utilizadoO número de amostras usadas na validação de um teste deve incluir o máximo de variantes genéticas presentes na população para a qual o teste vai ser utilizado População Europeia Vs População BrasileiraPopulação Europeia Vs População Brasileira Revalidação do teste com novas variantesRevalidação do teste com novas variantes Participação em testes de proficiênciaParticipação em testes de proficiência

47 Genética molecular dos sistemas eritrocitários na população brasileira Melhoria da qualidade e exatidão dos resultados imunohematológicos Melhoria da qualidade e exatidão dos resultados imunohematológicos Determinação de novas variantes alélicas não descritas em outras populações (DIA/166A, FY145, Rhnull) Determinação de novas variantes alélicas não descritas em outras populações (DIA/166A, FY145, Rhnull) Identificação de variantes alélicas de origem Africana (GATA, RHD, RHD-CE-D s, VS, DIIIa, DAR) Identificação de variantes alélicas de origem Africana (GATA, RHD, RHD-CE-D s, VS, DIIIa, DAR) Elaboração de protocolos de genotipagem eficientes Elaboração de protocolos de genotipagem eficientes

48 Genotipagem de grupos sanguíneos na clínica requer: –Conhecimento em grupos sanguíneos –Experiência na interpretação das reações de PCR utilizadas –Obtenção dos achados sorológicos e da história clínica do paciente antes de interpretar os resultados da genotipagem –Conhecimento dos genes que codificam os antígenos de GS e suas formas variantes (fenótipos e genótipos podem não correlacionar) na população estudada Genética molecular dos sistemas eritrocitários

49 A genotipagem de grupos sanguíneos é uma ferramenta útil na medicina transfusional e apresenta gradualmente um número crescente de aplicações. Torna-se poderosa quando associada a hemalutinaçãoA genotipagem de grupos sanguíneos é uma ferramenta útil na medicina transfusional e apresenta gradualmente um número crescente de aplicações. Torna-se poderosa quando associada a hemalutinação Os métodos moleculares permitem obter um melhor conhecimento da distribuição dos grupos sanguíneos e suas bases moleculares na população brasileiraOs métodos moleculares permitem obter um melhor conhecimento da distribuição dos grupos sanguíneos e suas bases moleculares na população brasileira Achados moleculares na população brasileira ajudam a desenvolver protocolos mais seguros para genotipagem de grupos sanguíneos em nossos laboratóriosAchados moleculares na população brasileira ajudam a desenvolver protocolos mais seguros para genotipagem de grupos sanguíneos em nossos laboratórios Genética molecular dos sistemas eritrocitários

50

51


Carregar ppt "Genética molecular dos sistemas eritrocitários: importância na prática clínica Lilian Castilho."

Apresentações semelhantes


Anúncios Google