A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Slide 1 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Treinamento no GRADEp Aplicação GeneAl.

Apresentações semelhantes


Apresentação em tema: "Slide 1 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Treinamento no GRADEp Aplicação GeneAl."— Transcrição da apresentação:

1 Slide 1 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Treinamento no GRADEp Aplicação GeneAl

2 Slide 2 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Autoria Autor Gustavo Cestari frainer Versão (número, data, autor) V1, junho de 2005 V2, 03 de agosto de 2005, Geyer

3 Slide 3 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Sumário da apresentação 1 Descrição Geral da Aplicação GeneAl 2 Funcionamento da Aplicação GeneAl 3 Utilização da Aplicação GeneAl

4 Slide 4 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl A Aplicaço GeneAl a aplicação GeneAl (Genetic Alignment) esta direcionada à resolução de problemas na área de biologia molecular classificados como Alinhamento de Seqüências Genéticas mais especificamente a GeneAl lida com o problema de, dada uma determinada seqüência genética, encontrar outras seqüências genéticas similares em bases de seqüências genéticas para isso a seqüência inicial tem que ser comparada com cada uma das seqüências nas bases este processo pode ser computacionalmente exigente em bases maiores a GeneAl usa distribuição para agilizar a procura distribuição entre escravos (Workers)

5 Slide 5 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Ambiente Esperado a GeneAl assume algumas propriedades sobre o ambiente onde ela roda existem várias bases de genes espalhadas pelo mundo em diferentes instituições e, por conseqüência, em várias células não é pratico modificar a localização destas bases, seja por questões de direitos autorais, seja pelo tamanho da base entretanto estas bases estão sendo compartilhadas com os outros usurários da grade um pesquisador, que pode estar em qualquer ponto da grade, possui uma seqüência genética e deseja encontrar outras seqüências similares este pesquisador pode ou não saber onde existem bases de genéticas

6 Slide 6 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Organização da Aplicação a GeneAl esta organizada em uma hierarquia de três níveis: 1º nível é composto por um GeneAl_Manager, que coordena o processamento inter-celular da aplicação 2º nível é composto por vários GeneAl_Masters, um para cada célula, responsável por coordenar a procura na base de seqüências da sua célula 3º nível é composto por vários GeneAl_Workers, distribuídos pelos computadores de cada célula e que realizam a comparação de seqüências a GeneAl ainda têm uma interface que permite o disparo do GeneAl_Manager, o acompanhamento da execução e a exploração dos resultados

7 Slide 7 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Célula Execução da geneAl A execução começa com o disparo de um GeneAl_Manager a partir da interface nodo BS base nodo base Célula nodo BS Célula base nodo BS GeneAl Manager nodo Interface

8 Slide 8 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Célula Execução da geneAl O GeneAl_Manager utiliza o serviço Discoverer para descobrir onde estão as bases de seqüências. nodo BS base nodo base Célula nodo BS Célula base nodo BS GeneAl Manager nodo Interface

9 Slide 9 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Célula Execução da geneAl O GeneAl_Manager cria GeneAl_Masters nos nodos que possuem as bases de seqüências nodo BS base nodo base Célula nodo BS Célula base nodo BS GeneAl Manager GeneAl Master nodo Interface

10 Slide 10 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Célula Execução da geneAl Os GeneAl_Masters criam alguns GeneAl_Workers, que são utilizados para processar as seqüências na base de seqüências BS base nodo base Célula BS Célula base nodo BS GeneAl Manager GeneAl Master nodo GeneAl Worker nodo Interface

11 Slide 11 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Célula Execução da geneAl Quando toda base tiver sido processada, cada GeneAl_Master envia as seqüências mais similares à original para o GeneAl_Manager BS base nodo base Célula BS Célula base nodo BS GeneAl Manager GeneAl Master nodo Interface

12 Slide 12 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Célula Execução da geneAl O GeneAl_Manager ordena as seqüências recebidas conforme a sua similaridade à original e entrega a lista de seqüências para a interface BS base nodo base Célula BS Célula base nodo BS GeneAl Manager nodo Interface

13 Slide 13 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Utilização da GeneAL a GeneAl pode ser controlada a partir de uma interface a interface pode ser disparada a partir do GradepDesktop a interface é composta por três abas: MW Control : disparo da execução App Params: controle da configuração Results: apresentação dos Resultados geralmente é preciso primeiro fazer algumas configurações antes de disparar uma execução a maioria pela interfce gráfica (ver a seguir) existe uma versão da interface para PDAs com interface similar, mas um pouco mais limitada

14 Slide 14 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Configuração Pârametros: jobCriteria: define como o trabalho é distribuído entre os GeneAl_Workers. O valor padrão deve servir para a maior parte dos casos e não precisa ser editado. ex: Fixed timeGoal: também utilizado para definir como funciona o escalonamento do trabalho entre os GeneAl_Workers. O valor deve ser um período de tempo em milisegundos. O valor padrão pode ser utilizado e não precisa ser editado. ex: maxResults: um inteiro. O número máximo de resultados que serão mostrados quando a computação terminar. ex: 100

15 Slide 15 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Configuração resourcePath: o caminho até o diretório onde o arquivo in.txt se encontra. O arquivo in.txt deve conter uma única seqüência genética que será a seqüência de entrada. Exemplo de resourcePath: /home/gtgradep/genome/recursos/ Exemplo de seqüência genética: TTTTCCTAACCCTAACCCTAACCCTAACCCT AACCCTAACCCT... masterNames: contêm os identificadores de computadores que contêm bases de seqüências genéticas nas quais devem ser realizadas as pesquisas. Os identificadores são separados uns dos outros por vírgulas. Automaticamente preenchido no início da aplicação com as bases encontradas. Este parâmetro só precisa ser editado se o usuário quiser limitar a busca a algumas bases específicas. ex: hostid:4e.umacélula,hostid:54.outracélula

16 Slide 16 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Disparo Start dispara a execução Stop termina a execução no meio Elapsed Time e Status mostram o tempo e a porcentagem concluída da execução a porcentagem indicada em Status é uma aproximação pode apresentar erros, principalmente se as bases utilizadas forem pequenas

17 Slide 17 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Resultados preenchido ao término de uma execução cada linha da tabela representa uma seqüência encontrada quando uma linha é selecionada os campos s1 e s2 mostram, respectivamente, a seqüência original e a seqüência atualmente selecionada, permitindo uma comparação

18 Slide 18 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Treinamento no GRADEp Aplicação GeneAl


Carregar ppt "Slide 1 Rede Nacional de Ensino e Pesquisa Treinamento em Gradep - junho 2005 Aplicação GeneAl Treinamento no GRADEp Aplicação GeneAl."

Apresentações semelhantes


Anúncios Google