A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Anotação de SAGE Tags Rodrigo Martins Brandão. SAGE A Bioinformática têm papel essencial para o SAGE em três funções básicas: extração e gerenciamento.

Apresentações semelhantes

Apresentação em tema: "Anotação de SAGE Tags Rodrigo Martins Brandão. SAGE A Bioinformática têm papel essencial para o SAGE em três funções básicas: extração e gerenciamento."— Transcrição da apresentação:

1 Anotação de SAGE Tags Rodrigo Martins Brandão

2 SAGE A Bioinformática têm papel essencial para o SAGE em três funções básicas: extração e gerenciamento dos dados anotação das tags análise estatística (distribuição e comparações)

3 SAGE Contagem das Tags Anotação das Tags Análise dos dados Experimento de SAGE

4 Extração das Tags Dados estão no formato de cromatogramas Software de Base Calling (Ex.: Phred) para gerar a sequência do concatâmero no formato texto com seu valor de qualidade Extração e contagem das tags

5 Contagem das Tags Localizar CATG Extração dos Ditags (20 – 26 pb) Descartar ditags duplicadas Obter as 10 bases extremas, sendo reverso complementar a da direita Descartar adaptadores (linkers) de sequências Contagem das tags



8 Contagem das Tags Softwares que fazem a extração e contagem das tag: SAGE 300 – Zhang et al. (1997) SAGE 2000 – Invitrogen, Inc. (I-SAGE) eSAGE – Margulies & Innis (2000) USAGE (On-line) – van Kampen el at. (2000) SAGEnhaft (On-line) – Beissbarth et al. (2004)

9 SAGE Contagem das Tags Anotação das Tags Análise dos dados Experimento de SAGE

10 Anotação de SAGE Tags A anotação (ou mapeamento) das SAGE tags, nos permite dar sentido biológico aos resultados ao identificar uma tag.

11 Anotação de SAGE Tags Tag, etiqueta, marcador, assinatura... É uma sequência de nucleotídeos de 9-10 pb. Uma Tag possui informação suficiente para a identificação de um transcrito único.

12 Anotação de SAGE Tags Mais de 1 gene pode estar relacionado a mesma tag; 1 gene pode estar relacionado a 1 ou mais tags diferentes;

13 Principais Problemas Erros de amostragens; Erros de sequênciamento; Possibilidade de tags não unívocas; Transcritos que não geram tags utilizando uma dada enzima; Sequências repetitivas;

14 Como Resolver? aumento do número de tags coletadas. uso de tags mais longas. uso de diferentes enzimas de restrição.

15 Anotação de SAGE Tags 1° Passo: Preparar a bilioteca de SAGE

16 Biblioteca de SAGE Short SAGE: ~14 pb Long SAGE: ~21 pb


18 Biblioteca de SAGE Número de tags de uma biblioteca: Soma das frequências de todas as tags Número de tags únicas de uma biblioteca quantidade de tags únicas existente

19 Biblioteca de SAGE Quanto maior o número de bibliotecas de um mesmo organismo melhor. As bibliotecas devem ser normalizadas.

20 Biblioteca de SAGE Gerar a lista das CSTs (Confident SAGE Tag): Remover tags com frequência igual a 1; Remover linkers de sequências linkers com variação de 1pb AAAAAAAAAA – AAAAAAAAAT

21 Anotação de SAGE Tags 2° Passo: Extrair as Tags Virtuais

22 Anotação de SAGE Tags Tag Virtual: é uma tag extraída computacionalmente. Encontrada nos 10 pb posterior ao sítio da enzima NlaIII na região 3' UTR em mRNA.

23 Extração das Tags Virtuais O sítio da enzima NlaIII é identificado pelas bases CATG. 5' 3' CGACGGTCATGAAATCGATACCGAAAAA

24 Extração das Tags Virtuais Cauda de Poli-A: quantidade de A nas ultimas bases. Sinal de Poli-A: AATAAA e ATAAAA nas últimas 50 bases.

25 Anotação de SAGE Tags 3° Passo: Relacionar as informações

26 SAGE Tags x Tag Virtual Relacionar Tag ao Gene Pode-se encontrar mais de uma tag relacionada a um mesmo gene. Qual a melhor Tag para o Gene? Ranking Tag com alta expressão (Maior pontuação). Tag virtual interna (Menor pontuação).

27 Ranking a tag mais próxima a região 3' de mRNAs com cauda poli- A; a tag mais próxima a região 3' de ESTs com cauda de poli- A (ou cabeça de poli-T); a tag mais próxima a região 3' de mRNAs com sinal de poli- A; a tag mais próxima a região 3' de mRNAs sem sinal e sem cauda poli-A; tags internas (as tags de número 4, 3 e 2) de mRNAs;

28 Extração das Tags Virtuais Onde encontrar os transcritos? Banco de dados públicos: UniGene, RefSeq. Caso não tenha, pode-se usar organismo filogeneticamente próximos para obter uma anotação prévia.

29 Links SAGEmap http://www.ncbi.nlm.nih.gov/projects/SAG E http://www.ncbi.nlm.nih.gov/projects/SAG E SAGEGenie http://cgap.nci.nih.gov/SAGE http://cgap.nci.nih.gov/SAGE

Carregar ppt "Anotação de SAGE Tags Rodrigo Martins Brandão. SAGE A Bioinformática têm papel essencial para o SAGE em três funções básicas: extração e gerenciamento."

Apresentações semelhantes

Anúncios Google