A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Seqüenciamento e montagem do genoma humano e análise de transcriptoma.

Apresentações semelhantes


Apresentação em tema: "Seqüenciamento e montagem do genoma humano e análise de transcriptoma."— Transcrição da apresentação:

1

2 Seqüenciamento e montagem do genoma humano e análise de transcriptoma

3 Seqüenciamento do Genoma Humano Embate: Consórcio público x Celera genomics: – Consórcio público: mapeamento físico, shotgun hieráriquico. – Celera genomics: whole genome shotgun Em fevereiro de 2001 foi publicada de forma independendente versão draft ou preliminar ambos grupos.

4 Seqüenciamento do Genoma Humano 2003: Consórcio público apresenta versão final do seqüenciamento do genoma humano –Comprimento total: 3 bilhões pb – 99% deste total foi seqüenciado –Erro de seqüenciamento estimado em 1/ nt – 99.9% não apresenta diferenças entre indivíduos. – genes –Genes codificadores de proteínas correspondem a apenas 2% do genoma – 50 % do genoma consiste de regiões repetitivas (D.melanogaster 3%, C.elegans 7%)

5 Celera Genomics – Iniciativa privada Whole genome shotgun (WGS) Genoma Biblioteca genômica Plasmídeo (inserto 10 kb) BAC (inserto 100 kb) Seqüenciamento das extremidades do inserto Leituras ou reads

6 Contig Mate pairs Celera Genomics – Iniciativa privada Whole genome shotgun (WGS) – Montagem AGCGTTA GTTACAAC AGCGTTACAAC

7 Contig Mate pairs Celera Genomics – Iniciativa privada Whole genome shotgun (WGS) – Montagem

8 Contig Mate pairs BAC contendo inserto de maior comprimento Celera Genomics – Iniciativa privada Whole genome shotgun (WGS) – Montagem

9 Contig Mate pairs Contig Scaffold Mate pairs Celera Genomics – Iniciativa privada Whole genome shotgun (WGS) – Montagem

10 Consórcio público Mapeamento físico, shotgun hierárquico Cromossomo Biblioteca genômica em BAC (inserto 100Kb) Fragmento cromossômico Biblioteca genômica em BAC

11 Consórcio público Mapeamento físico, shotgun hierárquico Cromossomo Biblioteca genômica em BAC (inserto 100Kb) Fragmento cromossômico Biblioteca genômica em BAC

12 BAC Biblioteca Plasmídeo (inserto 10 kb) Seqüenciamento das extremidades do inserto Leituras ou reads Consórcio público Mapeamento físico, shotgun hierárquico - Montagem

13 Contig Mate pairs AGCGTTA GTTACAAC AGCGTTACAAC Consórcio público Mapeamento físico, shotgun hierárquico - Montagem

14 Consórcio público Mapeamento físico, shotgun hierárquico Cromossomo Biblioteca genômica em BAC (inserto 100 kb)

15 Consórcio público Mapeamento físico, shotgun hierárquico Cromossomo Biblioteca genômica em BAC (inserto 100 kb)

16 Consórcio público Mapeamento físico, shotgun hierárquico Cromossomo Biblioteca genômica em BAC (inserto 100 kb)

17 Avaliação de estratégias de seqüenciamento Vantagens WGS Estratégia mais simples com menos etapas. Vantagens Shotgun Hierárquico Menos vulnerável que a estratégia WGS em relação a montagem de regiões repetitivas.

18 Avaliação de estratégias de seqüenciamento Repetições no genoma XX Cenário I X MontagemGenoma Processo de montagem é suscetível a erros quando empregado em genomas com alto índice de repeticões. WGS: Montagem de 3 bilhões de bases (todo genoma). Shotgun hierárquico: Montagem de 100 mil bases (inserto de cada BAC).

19 In silico

20 Base-calling Geração de uma seqüência de nucleotídeos através da análise dos chromatogramas PHRED gaattcggcacgagagttctcccggagacgctccgtgcgaagattatggaggccgtcaatgtggtcggttc ccgccactttgctcgcctgcgcatcgatgtaacagtccgtggtgacgaagtcataccgttaagtattacgt ttttgttgtcgttgttgcagcaatagtagaggacgggcgcttttttttttgtcaagagaaagggggagggg cgtactaccgctttatcgaggttggtattatttcttatatataaagggaaagagcaacgtgaagcgggtaa gggaagagtgaaagtcgag

21 Mascaramento Eliminar fragmentos de vetor cross_match >5 gctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcggcacgagagttc tcccggagacgctccgtgcgaagattatggaggccgtcaatgtggtcggttcccgccactttgctcgcctg cgcatcgatgtaacagtccgtggtgacgaagtcataccgttaagtattacgtttttgttgtcgttgttgca >3 gcaatagtagaggacgggcgcttttttttttgtcaagagaaagggggaggggcgtactaccgctttatcga ggttggtattatttcttatatataaagggaaagagcaacgtgaagcgggtaagggaagagtgaaagtcgag ggggggcccggtacccaattc

22 Montagem Produzir uma seqüência contígua através de seqüências menores que possuam regiões de sobreposição PHRAP, Celera Assembler, Arachne contig leituras

23 Anotação Localizar na seqüencia genômica final: Genes que codificam proteínas e RNAs não traduzidos (tRNA, rRNA, snRNA) Determinar, se possível, o produto provável de cada gene encontrado. Associar cada gene à uma categoria funcional ou via metabólica. Ex.: síntese de lipídeos, maquinaria de tradução, fosforilação oxidativa, etc.

24 Anotação Streptococcus pneumoniae R6

25 Anotação Automática Glimmer contig RBSfindertRNAscanGeneMark CDS

26 Anotação Automática BLAST contra KEGG InterproBLAST contra GenBank PSORTBLAST contra COG Anotação manual

27 Alinhamento Determinar o grau de similaridade entre duas ou mais seqüências, ou entre fragmentos de seqüências. Inferir homologia entre genes: parálogos, ortólogos.

28 Alinhamento local Similaridade pode se ater a regiões de cada seqüência

29 BLAST (Basic Local Alignment Search Tool) BLAST KEGG COG GenBank Nucleotídeos > SEQ1 atgggcacgagagttctcccggagac gctccgtgcgaagattatggagg ccgtcaatgtggtcggttcccg ccactttgctcgcctg Bancos de seqüências GenBank Proteínas

30 BLAST (Basic Local Alignment Search Tool) Aldolase Trypanosoma cruzi acaagctggagctcccgcggtggtcggcgctctagaactagtggatcccccgggctgcaggaattcggcacgagaacaacttcaaccgcgtctggaaggc gccacgccgcccgtttgagaaggaacgccttgaccgcgagatgaaactctgcggccagtacggccttcngttgcaacgcgtgagatttggcgccgtgaac atgacgctctccaagatgcgtcgtaccgcccgtctgttgttgacgttgccggagaaccacccgcgccggcagctggagggttccgccatcatgcgccgct gccacgactacggcttcctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacannattcactggccgntcgntnntttacaacgtc gntnngactgggnannaaaccctggnnncgttacccaacttaatcgcctt BLAST it!

31 Anotação Automática BLAST contra KEGG InterproBLAST contra GenBank PSORTBLAST contra COG Anotação manual

32 Aldolase Trypanosoma cruzi acaagctggagctcccgcggtggtcggcgctctagaactagtggatcccccgggctgcaggaattcggcacgagaacaacttcaaccgcgtctggaaggc gccacgccgcccgtttgagaaggaacgccttgaccgcgagatgaaactctgcggccagtacggccttcngttgcaacgcgtgagatttggcgccgtgaac atgacgctctccaagatgcgtcgtaccgcccgtctgttgttgacgttgccggagaaccacccgcgccggcagctggagggttccgccatcatgcgccgct gccacgactacggcttcctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacannattcactggccgntcgntnntttacaacgtc gntnngactgggnannaaaccctggnnncgttacccaacttaatcgcctt Interpro Procura na seqüências por domínios, assinaturas ou motivos conhecidos. Se utiliza de outros bancos de domínios para produzir seu relatório final. PFAM, SMART, PROSITE, etc Interpro

33 Anotação Automática BLAST contra KEGG InterproBLAST contra GenBank PSORTBLAST contra COG Anotação manual

34 Anotação Streptococcus pneumoniae R6

35 Sabiá System for Automated Bacterial Integrated Annotation LNCC – Coordenação do Projeto Genoma Brasileiro Gerenciamento de todos softwares de Base-calling, Mascaramento, Montagem e Anotação automática. Disponibilização da Anotação automática dos resultados via Web possibilitando a realização da Anotação manual por pesquisadores distribuídos geograficamente. Exemplo SabiáMapa AntesMapa Depois

36 Análise do transcriptoma Projetos que precedem seqüenciamento do genoma nuclear: Identificação de novos genes. Estimativa do perfil de expressão da linhagem celular, estágio de desenvolvimento ou tecido avaliado

37 Transcrição e Transcriptoma EST RNA total cístron Poli A mRNA CAP 5 3

38 Transcrição e Transcriptoma EST Poli A cDNA Vetor + cDNA

39 Transcrição e Transcriptoma EST Sequenciamento extremidades 5 Poli A ~ 800 pb Vetor cDNA completo

40 Transcrição e Transcriptoma EST Remoção Sequencia de vetor (cross_match, Lucy) Remoção Poli A (Script Perl) EST 5 Poli A 3 Vetor Poli A X X X 53 53

41 Análise do transcriptoma EST – Anotação BLASTX E BLASTN GenBank Nucleotídeos >clone_23 5 ggcacgagagttctcccggagac gctccgtgcgaagattatggagg ccgtcaatgtggtcggttcccg ccactttgctcgcctg Bancos de seqüências GenBank Proteínas 53 clone_23 5 = amastina

42 Análise do transcriptoma EST – Anotação Agrupamento de seqüência similares ou agrupamento via anotação = amastina >clone_23 5 ggcacgagagttctcccggagac gctccgtgcgaagattatggagg ccgtcaatgtggtcggttcccg ccactttgctcgcctg Número de ESTsAnotação 4amastina 6TcMUC II

43 Transcrição e Transcriptoma Transcriptoma de amastigotas

44 Transcrição e Transcriptoma Transcriptoma de amastigotas


Carregar ppt "Seqüenciamento e montagem do genoma humano e análise de transcriptoma."

Apresentações semelhantes


Anúncios Google