A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Www.lge.ibi.unicamp.br Mistérios Moleculares da Vassoura de Bruxa Gonçalo Guimarães Pereira UNICAMP Salvador - Bahia 23/04/04.

Apresentações semelhantes


Apresentação em tema: "Www.lge.ibi.unicamp.br Mistérios Moleculares da Vassoura de Bruxa Gonçalo Guimarães Pereira UNICAMP Salvador - Bahia 23/04/04."— Transcrição da apresentação:

1 Mistérios Moleculares da Vassoura de Bruxa Gonçalo Guimarães Pereira UNICAMP Salvador - Bahia 23/04/04

2 Basis Organism Gene Biochemistry Discover the function of the Gene A in the Organism X Genomics Discover that the Organism Y has a gene similar to the Gene A found in the Organism X A(Y) ~ A(X)

3 Genomics Tools Organism Raw Sequence Putative Genes Cellular Program Sequencing BioinformaticsExpression Analysis

4 Genomics Mission Genomics X Trial and Error Hypothesis for Targets Definition

5 Genome Xylella fastidiosa 3 Mb 50 kb 1 a 2 kb 50 kb Sequencing ATGGGCCTTTG CTTTGCCCCCAAA TGCCCCCAAAAGGGGG AAAGGGGGAAAAG ATGGGCCTTTGCCCCCAAAAGGGGGAAAAG CCTGGGGGATGGGCCTTTGC AGGGGGAAAAGTTTGC Identification of genes ATGCT Bioinformatics

6 BLAST Virtual Metabolism

7 Publication

8 More

9 Xylella fastidiosa - Pierce's Disease Strain: Grape phytopathogen Leifsonia xyli subsp. xyli (Sugarcane phytopathogen) Leptospira Eucalyptus Coffee Caw and more....

10

11 Regional Genomes Leishmania chagasi Schistosoma mansoni Trypanossoma cruzi Paracoccidioides brasiliensis Human diseases Agriculture improvement Herbaspirillum seropedicae Gluconacetobacter diazotrophicus Eucalyptus Phytopathogen Crinipellis perniciosa

12 Samba, football and..... Genomics

13 Practical Results ????????????

14 Cacau Production in Brazil Thousand Tons

15 International Price

16 Cacau Income U$ Billion

17 Witche’s Broom Loses U$ Million U$ , jobs ha Forest

18 Goals of the Witch's Broom Genome Project Pragmatic 2. Create the basis to understand the Witch's Broom disease, indicating possible solutions 1. Build a Genomics Network at the State of Bahia to face biological problems

19 Symptoms - 1 Fotos - João de Cássia - CEPEC-CEPLAC

20 Fotos - João de Cássia - CEPEC-CEPLAC Symptoms - 2

21 Fotos - João de Cássia - CEPEC-CEPLAC Symptoms - 3

22 Crinipellis perniciosa Fotos - João de Cássia - CEPEC-CEPLAC

23 Life Cycle Differentiation Meiose

24 Complexity X Strategy Prokaryotes Eukaryotes Fungi - Saccharomyces cerevisiae Human ATGCT ATGCT ATGCT ATGCT ~ 3 Mb 1G/1Kb ~ 20 Mb 1G/2Kb ~3.000 Mb 1G/75 Kb ATG (?)CT

25 Sequencing X Coverage Singlets Contigs

26 1X 2X 303 >1000bp Gaps X Coverage

27 Sequencing Strategy 20 Kb 40 reads: 500 bp/each 3 reads Genomic Shotgun

28 Bahia Genomics Network UESC CEPLAC CENARGEN UNICAMP DNA Coordination UNICAMP UFBA-Farmácia UFBA- IB UEFS UCSAL Databank Bioinformática UNICAMP/UESC Interface Cacau Research Community Libraries Sequences

29 Data Treatment: “on going” annotation Shotgun Blast Pre-Annotated Read Local clustering ORFs Assembling BACs Complete Genome Representative Read Chips Molecular Mapping Inactivation Structural Analysis Proteomics Metabolic Maps

30 Bioinformatics Services Serviços Labs productivity Labs productivity graphs (cumulative) Quality Administrative services Access control Access control (graph) Bug reports Sequence submission Nomenclature Nomenclature edition Submission test Keyword search in Blast files Anotation (test) Annotated seeds Contigs progress Sequence pattern search Blast against C. perniciosa Blast results - All reads Sequence analysis tools (Emboss) Library Control Strain GeraçãoControleAnálise Gene Project

31 Gene Project* Data bank: Blasted reads Selected reads Assembled Reads Consensus Annotated Gene *Carazzolle, MF, Digiampietri, L, Araújo, MRS, Formighieri, EF, Tsukumo, F & Pereira, GAG Selection: File, Keyword, Blast, Seq. pattern, all Assembling: PPC, Saturation Blast of consensus Analysis: ORF finder, Comparison, Prediction

32 Chitin Metabolism UDP-N-Acetilglicosamina CHITIN N-Acetylglicosamine-1- phosphate N-Acetylglicosamine-1- phosphate Glucosamine-6- phosphate Glucosamine-6- phosphate Glutamine Glutamate AcetylCoA CoA UTP N-Acetylglucosamine UDP Chitobiose N-Acetylglucosamine-6-hosphate pyrophosphate Chitosan Fructose-6- phosphate Fructose-6- phosphate Glucose-6-phosphate Glucosaminide Glucosamine ATP ADP ATPADP Nc, Sc, Sp, Cp Nc, Sc, Cp Only Nc None Goes-Neto, Priminho, et. Al UEFS

33 ControlInfected DAIPhases Biochemistry of Infection - 1 Ph.D. Work: Leandra Scarpari; Supervisor: Gonçalo Pereira; Co-supervisors: Paulo Mazzafera e Alan Pomella Acknowledge: Almirante Cacau

34 Biochemistry of Infection - 2 Component > Control> InoculatedNo Diference Açucares - Solúveis totais XXX - Sacarose XXX - AmidoXXX - HemiceluloseXXX - Açúcares redutores XXX - Celulose XXX - Pectinas XXX Aminoácidos Quantitativo XXX Qualitativo ***ASP, GLU ASN Fenóis totais XXX Taninos XXX Nitrato XXX Flavonóides totaisXXX Clorofilas e carotenóidesXXX Hormônios Etileno XXX Auxina Citocinina Açucar Solúvel Hemicelulose AA - Controle AA - Inoculado AA - Total Amido Flavonóides Totais Clorofila Total

35 Biochemistry of Infection - 3 C I Acido Glutâmico Asparagina The infection triggers the plant Programmed Cell Death - PCD

36 Tunnel

37 S. cerevisiae + H. wingei (Bio Rad) 2. CP02 (Biótipo C) 3. CP09 (Biótipo C) 4. FA42 (Biótipo C) 5. Ilhéus (Biótipo C) 6. FA104 (Biótipo S) 7. SCFT (Biótipo L) 8. FA322 (Biótipo L) 9. S. pombe 10. S. cerevisiae CSL Molecular Features Rincones, J, Meinhardt, L, Vidal, B & Pereira, GAG

38 (2) (3) 29 Mb Genome Size

39 Genome Variability BahiaIII Amazônicos Probably only two clones of C. perniciosa have been introduced in Bahia

40 Telomeric PCR III Bahia A1-R 1018 bp 1636 bp 2036 bp 3054 bp 517 bp III Bahia A1 Meinhardt, L, Rincones, J. & Pereira, GAG

41 Amazônicos Rondônia????

42 Genetic Solution Creation of strict sanitary barriers between Amazonia and Bahia

43 Transposons S C C L Class I Super-family Gypsy/Ty3 Marisa Queiroz - UFV M L S U P B 394 Reverse Trancriptase S C C L Impala-like S C C L Restless-like

44 Transposon Distribuition

45 Variability Dynamics Homobasidiomycete Sexual Phase ??? Meioses 1. Cromossomal variations can be immediately fixed 2. Variability may raise by mutation and transposons 3. Why we do not see higher variability in Bahia????

46 Mitochondria

47 Senescence Kalilo - like 109 kb

48 Senescence Waves Hugo

49 Alternative Oxidase C. perniciosa Alternative Oxidase

50 Recommendations 1. Strobirulin based fungicides are ineffective at the field 2. Inhibition of mitochondria may be effective to control the disease and could be achieved by combining strobirulin and Sham analogues

51 Acidocalcisome ??? Nuclei ???

52 Homeostase Ca

53 Necrosis Factor Phytophthora Crinipellis C. perniciosa VV VS G M RT-PCR do gene indutor de etileno e necrose ~ 4 paralogs No introns Secreted UESC & UNICAMP Expressão, Estrutura e Regulação

54 Fátima Alvim - UESC Necrosis Induction

55 Dr. Lyndel Mainhardt Plant X Pathogen BT NC

56 Biotrophyc Hyfas

57 First Global Expression

58 Ethylene Formation

59 Chemical Genomics ATOM 1 N PHE N ATOM 2 CA PHE C ATOM 3 C PHE C ATOM 4 O PHE O ATOM 5 CB PHE C ATOM 6 N SER N ATOM 7 CA SER C ATOM 8 C SER C ATOM 9 O SER O ATOM 10 CB SER C ATOM 11 N ASP N ATOM 12 CA ASP C ATOM 13 C ASP C ATOM 14 O ASP O ATOM 15 CB ASP C Target Structure Structures (18/02/03) Chemical Libraries Molecular Docking Molecular Design

60 “Omics” Era Genomics Metabolomics TranscriptomicsProteomics Economics

61 Malaria Nature 419, (2002)

62 The Regress

63 Price Reaction Fonte: Thomas Hartman Início.

64 Homepage

65 Team COORDENAÇÃO Gonçalo Amarante Guimarães Pereira - Júlio Cascardo COORDENADORES DE CENTROS CEPLAC Raúl René Meléndez Valle e Karina Gramacho EMBRAPA - Dário Gratapaglia UESC -Júlio Cascardo e Dário Ahnert UNICAMP - Gonçalo Guimarães Pereira UFBA - FC - Marilda Gonçalves UFBA - IB – Luciana Veiga UEFS - Aristóteles Goes Neto e Carlos Priminho Pirovani UCSAL - Luzimar Gonzaga GERÊNCIA E ASSESSORIA JURÍDICA Eliane Laranja Dias e Leonardo Grecco COORDENADORAS DNA Carolina Cotomacci - Dirce Maria Carraro CONSULTORES DNA Anderson Ferreira da Cunha e Helaine Carrer PLANTA X PATÓGENO Leandra Scarpari, Allan Pomella e Lyndel Meinhardt BIOINFORMÁTICA Marcos Renato Araujo, Luciano Digiampetri, Marcelo F. Carazzolle e Eduardo Formigheri SEQÜENCIAMENTO Carolina Cotomacci, Raquel, Anrdéa de Assis, Camilla Ramos Vitor Almeida, Robson, Monica, Luana, Reimar Maíza Alves Lopes e Bruno Motta Oliveira MAPEAMENTO MOLECULAR Johana Rincones, Lyndel Maynhardt CICLO SEXUAL Carolina Cotomacci ECOLOGIA MOLECULAR / MITOCÔNDRIA Naiara Sardinha Pinto, Eduardo Formigheri EXPRESSÃO GLOBAL Maricene Sabha e Leandra TRANSFORMAÇÃO DO FUNGO Marisa Queiroz

66 GENÉTICA VEGETAL Acássia Benjamim Leal Pires Alana Maria Cerqueira de Oliveira Fábio Gelape Faleiro Fátima Cerquira Alvim José Antonio Peters José Bonadie Marques José Luis Pires Júlio Cézar de Mattos Cascardo Leandro Lopes Loguércio Luana Mahé Costa Gomes Milton Macoto Yamada Mônica Menezes Passinho Mônica Rosa Bertão Reinaldo Figueiredo dos Santos Rita de Cássia Siqueira Bahia de Assis Uilson Vanderlei Lopes Wilson Reis Monteiro BIOQUÍMICA Paulo Mazzafera SISTEMÁTICA DE FUNGOS Aristóteles Goes Neto SISTEMÁTICA VEGETAL Cíntia Schultz Coimbra FISIOLOGIA VEGETAL Marco Antonio Galeaas Aguilar Raúl René Meléndez Valle FITOPATOGIA Carlos Priminho Pirovani Edna Dora M. N Luz Givaldo Rocha Niella Jadergudson Pereira João de Cássia do Bomfim Costa João Louis Pereira José Lauereano José Luis Bezerra Karina Peres Gramacho Marival Lopes de Oliveira Stela Dalva M. N. Silva MICROSCOPIA ELETRÔNICA Stela Silva e Paulo Joazeiro Team - 2

67 Funding Fapesp

68 Economical Perspectives

69 Biotech Process Alcohol Fermentation

70


Carregar ppt "Www.lge.ibi.unicamp.br Mistérios Moleculares da Vassoura de Bruxa Gonçalo Guimarães Pereira UNICAMP Salvador - Bahia 23/04/04."

Apresentações semelhantes


Anúncios Google