A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Modelos de Computação e Computação usando DNA. 1900: Conjectura de Hilbert: todo problema bem posto seria demonstrável. Hilbert procurava um algoritmo.

Apresentações semelhantes


Apresentação em tema: "Modelos de Computação e Computação usando DNA. 1900: Conjectura de Hilbert: todo problema bem posto seria demonstrável. Hilbert procurava um algoritmo."— Transcrição da apresentação:

1 Modelos de Computação e Computação usando DNA

2 1900: Conjectura de Hilbert: todo problema bem posto seria demonstrável. Hilbert procurava um algoritmo que para qualquer sentença, dadas as hipóteses suficientes demonstrasse a sentença. Até 1931 essa conjectura era aceita.

3 Teoremas da Indecibilidade Kurt Gödel (1931): 1. Se o conjunto de axiomas é consistente então existem teoremas que não podem ser provados nem refutados. 2. Não existe procedimento construtivo que prove ser consistente uma teoria axiomática. Nenhum sistema formal expressivo o suficiente pode ser consistente e completo.

4 1936: Kleene e Church apresentam o -Calculus. Kleene: define o formalismo Funções Recursivas (usando as funções primitivas recursivas de Dedeking usadas por Gödel no teorema da não completude). Kleene: Funções Recursivas -Calculus Church: mostrou, usando Funções Recursivas ou - Calculus como definição de algoritmo que a conjectura de Hilbert estava errada. Church: Tese de Church Tais formalismos são caracterizações tão gerais da noção de efetivamente computável quanto consistente com o entendimento intuitivo usual

5 Evidências Externas Turing: Máquinas de Turing Post: Sistemas Canônicos de Post Markov: Algoritmos de Markov Shepherdson e Stürgis: Máquinas de Registradores Elgot e Robinson: RASP (Randon Acess Stored Programs)

6 Máquina de Turing papel lápis pensamento Papel: unidimensional, dividido em quadradinhos = fita infinita. Alfabeto: finito Estados de consciência: finitos estou no início terminei

7 Comportamento num dado momento depende: estado de consciência, símbolo sob sua atenção. Comportamentos possíveis: Observar ou mudar o símbolo somente de um quadradinho de cada vez, Transferir a atenção para o quadradinho vizinho, da direita ou da esquerda;

8 - Máquinas de Turing com várias fitas; - Máquinas de Turing não determinísticas - Máquinas de Turing universal Problema da Parada: Existe um algoritmo (MT), que dado m, a codificação de uma máquina de Turing M e uma palavra w, qualquer sobre o alfabeto de entrada da máquina M, decida se M pára (aceitando ou rejeitando) com a entrada w, ou não? Não existe tal algoritmo, o Problema da Parada é portanto não solucionável. Evidências Internas

9 Um problema ser solucionável é suficiente? Problema: calcular o determinante de uma matriz Algoritmo: usa a definição de determinante Método de Gauss: matriz 20 x 20 resposta em 38,63 ms matriz 2 x 2resposta em 22 ms matriz 5 x 5 matriz 10 x 10 matriz 20 x 20 resposta em 2,35 ms resposta em 1,19 min resposta em séculos

10 Algoritmo + Eficiência Eficiência: complexidade polinomial P: classe dos problemas que possuem algoritmo determinístico de complexidade polinomial; NP: classe dos problemas que possuem algoritmo não determinístico de complexidade polinomial. P = NP ? A resposta vale Um milhão de dolares!

11 NP-Completo: os mais difíceis entre os problemas NP. Possuem a propriedade de: se um problema p NP tem algoritmo determinístico de complexidade polinomial, qualquer problema de NP tem algoritmo determinístico de complexidade polinomial, isto é P = NP. Criptografia Se P = NP

12 Satisfiability; 3SAT; Caixeiro Viajante; Circuito Hamiltoniano; Problema da Mochila; TimeTable Design; Problemas de escalonamento. Problemas NP-Completos

13 Como implementar a Máquina de Turing? Construindo um computador....

14 Construção da Solução de um Problema em Computador Codificar dados Codificar programa Executar CHIP Resultado:

15 Construção da Solução de um Problema usando DNA Codificar dados Codificar programa Executar ATTACGATGC GCATATATCC PCR Screening Enzimas Eletroforese... Resultado: ATTGCTGTGCCCTA

16 Computação usando DNA Paralelismo maciço Complementaridade (Watson-Crick) Adleman´94

17 Exemplo: Caminho Hamiltoniano Detroit Atlanta ChicagoBoston Partida Chegada

18 Atlanta ACTTGCAG Boston TCGGACTG Chicago GGCTATGT Detroit CCGACGAA TGAACGTC AGCCTGAC CCGATACA GGCTCGTT Codificação das Cidades NomeComplemento

19 Atlanta ACTTGCAG Boston TCGGACTG Chicago GGCTATGT Detroit CCGACGAA Geração das Seqüências ComplementoNome

20 TCGGGCAG GCAGCGAC TGACGGCT TGACCGAC TGACTTAC ATGTCGAC Atlanta Boston Atlanta Detroit Boston Chicago Boston Detroit Boston Atlanta Chicago Detroit Codificação do Vôos

21 Codificação do Programa Passo 1 - Gerar todos os caminhos possíveis

22 Codificação do Programa Passo 1 - Gerar todos os caminhos possíveis

23 Passo 2 - Remover caminhos que não iniciem e não terminem nas cidades desejadas Primers PCR

24 Passo 2 - PCR...

25

26

27

28 Passo 3 - Selecionar os caminhos que tem exatamente quatro vértices (24 pares de bases) Eletroforese

29 Passo 4 - Selecionar os caminhos que passam por todas as cidades GCAGTCGGACTGGGCTATGTCCGA AGCCTGAC -

30 Passo 5 - Se não sobraram seqüências no tubo não existe o caminho procurado Se sobraram, elas representam os caminhos Hamiltonianos procurados.

31 Contribuições da Biologia na Computação Computação usando DNA Ainda não é viável (mas o computador já havia sido inventado em 1810 por Charles Babbagge, muito antes de realmente poder ser construído) Idéias de novos modelos computacionais, novas estruturas de dados, novas arquiteturas,...

32 Contribuições da Computação na Biologia Ferramentas para análise, visualização, armazenamento e busca de dados,... Ajudar a entender como a natureza computa... ATCCCGTACGTCGTTTGCGCGAAT CGTAGCTGGGTATCGTAGTGCTGA CGTAGCTGACTGATCGGGATCAAT ACGTGTGTGTGAAACTCAGTGATC ACGTTGATCGATCTGTCGACACAA


Carregar ppt "Modelos de Computação e Computação usando DNA. 1900: Conjectura de Hilbert: todo problema bem posto seria demonstrável. Hilbert procurava um algoritmo."

Apresentações semelhantes


Anúncios Google