A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Métodos para Inferência de Haplotypes UNIVERSIDADE FEDERAL DE PERNAMBUCO.

Apresentações semelhantes


Apresentação em tema: "Métodos para Inferência de Haplotypes UNIVERSIDADE FEDERAL DE PERNAMBUCO."— Transcrição da apresentação:

1 Métodos para Inferência de Haplotypes UNIVERSIDADE FEDERAL DE PERNAMBUCO

2 2 Roteiro  Introdução  Métodos Método de Clark Parcimônia Pura Filogenia Perfeita  Ferramentas HapBlock HaploSNPer

3 3 Introdução - Cruzamento AAATTT AAAATT AAATTT AAAATT 9 meses depois...

4 4 Introdução - Resultado AAAGTT AAAATT

5 5 Introdução – Seqüenciando o Bebê AAAGTT AAAATT = AAA?TT Nucleotídeo Indefinido Dados abundantes e baratos de serem obtidos (Genotype)

6 6 Introdução – SNP AAATTTAAAAAACTTATAAAAAGCTCTCAAAAATATATGAGACGCGCG AATTTTAAAAAACTAATAAAAAGCTTTCAAAAATATATGAGACGCGCG AAATTTAAAAAACTTATAAAAAGCTTTCAAAAATATATGAGACGCGCA AAATTTAAAAAACTATATAAAAGCTCTCAAAAATATATGAGACGCGCG AAATTTAAAAAACTAATAAAAAGCTCTCAAAAATATATGAGACGCGCG AAATTTAAAAAACTTATAAAAAGCTCTCAAAAATATATGAGACGCGCA AATTTTAAAAAACTTATAAAAAGCTCTCAAAAATATATGAGACGCGCG AATTTTAAAAAACTTATAAAAAGCTCTCAAAAATATATGAGACGCGCA

7 7 Introdução – SNP A T C G T T T G A T T A A A C G A T C G A T C A T T C G T T C A

8 8 Introdução – SNP A 1 T 0 C 1 G 0 T 0 T 0 T 0 G 0 A 1 T 0 T 0 A 1 A 1 A 1 C 1 G 0 A 1 T 0 C 1 G 0 A 1 T 0 C 1 A 1 T 0 T 0 C 1 G 0 T 0 T 0 C 1 A 1

9 9 Introdução – SNP A 1 T 0 C 1 G 0 T 0 T 0 T 0 G 0 A 1 T 0 T 0 A 1 A 1 A 1 C 1 G 0 A 1 T 0 C 1 G 0 A 1 T 0 C 1 A 1 T 0 T 0 C 1 G 0 T 0 T 0 C 1 A 1 Genotype: T/A T C A/G Haplotypes:TTCA ATCG

10 10 Introdução – SNP A 1 T 0 C 1 G 0 T 0 T 0 T 0 G 0 A 1 T 0 T 0 A 1 A 1 A 1 C 1 G 0 A 1 T 0 C 1 G 0 A 1 T 0 C 1 A 1 T 0 T 0 C 1 G 0 T 0 T 0 C 1 A 1 Genotype: Haplotypes:

11 11 Método de Clark  O Método de Clark foi a técnica mais utilizada no passado para inferência de haplotypes e ainda continua sendo empregado com freqüência;  Trata-se de uma abordagem estocástica, garante uma boa solução, entretanto não garante a melhor solução possível;

12 12 Passos do Método de Clark  Primeiramente reconhecer na matriz de entrada aqueles genotypes que não apresentam ou que apresentam somente um sítio ambíguo. Pois esses genotypes apresentam soluções já conhecidas;  Os Haplotypes gerados na etapa anterior serão usados como base de dados para resolver os demais genotypes;

13 13 Passos do Método de Clark  Cada Genotype cuja solução já é conhecida é marcado como resolvido e os Haplotypes gerados são adicionados a lista de Haplotypes deduzidos;  No Método de Clark os Genotypes não marcados são explicados usando um Haplotype anteriormente deduzido e um novo Haplotype deduzido;

14 14 Regra de Inferência do Método de Clark  Suponha que A é um vetor-genótipo ambíguo com h sítios ambíguos e R é um vetor resolvido que é uma dos 2h-1 resoluções do vetor A. Infira, então, que A é a confluência de uma cópia do vetor resolvido R e outro (determinado) vetor resolvido NR. Todas as posições ambíguas em A são definidas em NR em oposição ao registrado em R. Uma vez inferido, o vetor NR é adicionado ao banco de vetores resolvidos conhecidos, e o vetor A é removido do banco de vetores ambíguos.

15 15 Método de Clark - Exemplo  Exemplo 1:

16 16 Método de Clark - Exemplo  Exemplo 2: órfão!

17 17 Método de Clark - Exemplo Genotypes Haplotypes 1001 Primeiramente Selecionar os Genotypes que não possuem ambigüidade (sitíos = 2)

18 18 Método de Clark - Exemplo Genotypes Haplotypes 1001 Verificar se na lista de Haplotypes existem vetores que explicam 2201, ou se algum vetor já existem mais um novo vetor explica o Genotype ______

19 19 Método de Clark - Exemplo Genotypes Haplotypes ______ Verificar se na lista de Haplotypes existem vetores que explicam 2002, ou se algum vetor já existem mais um novo vetor explica o Genotype

20 20 Método de Clark - Exemplo Genotypes Haplotypes ______ 2 2 Verificar se na lista de Haplotypes existem vetores que explicam 2222, ou se algum vetor já existem mais um novo vetor explica o Genotype

21 21 Método de Clark - Exemplo Genotypes Haplotypes ______ Verificar se na lista de Haplotypes existem vetores que explicam 0220, ou se algum vetor já existem mais um novo vetor explica o Genotype

22 22 Método de Clark - Exemplo Genotypes Haplotypes RESULTADO FINAL

23 23 Parcimônia Pura  Tem como objetivo encontrar o menor conjunto possível de Haplotypes distintos que explicam o conjunto de Genotypes;  Justificativa: em populações naturais o número de Haplotypes distintos é imensamente menor que o tamanho da população;

24 24 Parcimônia Pura  Resolvido por Programação Linear Inteira  Pior caso com número exponencial de inequações  Na prática é gerado número polinomial de inequações.

25 25 Parcimônia Pura - Restrições  i = Indica a linha da matriz de entrada  j = Indica a coluna da matriz de entrada  y = representa a matriz de Haplotypes

26 26 Parcimônia Pura - Restrições  k – identifica um haplotype gerado  k’- identifica um haplotype gerado menor que k  d – identifica todas as possíveis combinações de k com todos os seus k’s

27 27 Parcimônia Pura - Restrições  x – identifica cada possível haplotype gerado como solução

28 28 Parcimônia Pura - Exemplo Genotypes ??? ??? 01? 01? ?11 ?11 Haplotypes ????? ???? ??? ?? ? Comparação ?????? Resultado K K’

29 29 PPH – Perfect Philogeny Haplotyping Forma uma Filogenia Perfeita!

30 30 PPH – Perfect Philogeny Haplotyping NÃO forma uma Filogenia Perfeita! Back Mutation ,

31 31 PPH – Perfect Philogeny Haplotyping Ancestral UMA mutação por sítio! Forma uma Filogenia Perfeita! Número de Haplotypes diretamente dependente do número de Genotypes!!!! Podendo haver sinônimos O número de Haplotypes deveria ser dependente do número de sítios!

32 32 Máximo sub-grafo comum  Dado dois grafos G 1 e G 2  Questão: Qual o maior sub-grafo induzido de G 1 que é isomórfico ao grafo G 2 ?  Se G2 é um subgrafo de G1 e possui toda a aresta (v, w) de G1 tal que ambos, v e w, estejam em V2, então G2 é o subgrafo induzido pelo subconjunto de vértices V2.subgrafosubconjunto

33 33 Problema Isomorfismo de Grafo Um isomorfismo dos grafos G e H é uma bijeção entre os vértices de G e de H tal que quaisquer dois vértices u e v são adjacentes em G sse f(u) e f(v) são adjacentes em H. O problema de isomorfismo de grafos consiste em responder se dois grafos dados G e H têm ou não têm um isomorfismo. Este é um problema de decisão NP-completo, o que significa que atualmente não se conhece um algoritmo polinomial para resolvê-lo.

34 34 Problema Isomorfismo de Grafo Grafo GGrafo HIsomorfismo entre G e H ƒ(a) = 1 ƒ(b) = 6 ƒ(c) = 8 ƒ(d) = 3 ƒ(g) = 5 ƒ(h) = 2 ƒ(i) = 4 ƒ(j) = 7

35 35 Problema Isomorfismo de Subgrafo Definição: Isomorfismo de Subgrafo ( G1, G2) (PROBLEMA DE DECISÃO) Entrada: grafos G1, G2 Pergunta: G1 é isomorfo a algum subgrafo de G2?

36 36 Problema Isomorfismo de Subgrafo O problema Isomorfismo de Subgrafo é uma generalização do problema Isomorfismo de Grafos, portanto é pelo menos tão difícil quanto este.

37 37 PPH - Solução  P-Class: Máximo Sub-Grafo Comum  P-Class: consistem em 2 sub- arvores Matriz de Genotypes Uma Solução PPH root Sítios: Genotypes a b c d a b c d a,d a,c b,d b,c

38 38 PPH – Algoritmo  Estrutura de Dados: Shadow Tree  Operações sobre essa estrutura: Adição de arestas Flip de arestas Merge de Classes Shadow

39 39 PPH – Algoritmo (Linha 1) Quais as colunas apresentam entrada 2 pela primeira vez ? 1, 2, 3 Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? NENHUMA

40 40 PPH – Algoritmo (Linha 2) Quais as colunas apresentam entrada 2 pela primeira vez ? 5, 6 Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ?

41 41 PPH – Algoritmo (Linha 3) Quais as colunas apresentam entrada 2 pela primeira vez ? 4, 7 Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 1, 2, 3, PROBLEMAS: mais de um sítio ancestral ambíguo Antes de realizar as inserções: alterar a árvore com uma operação de tal forma que contenha um ramo que uso o máximo dos vértices 1,2,3,6 começando pelo maior

42 42 PPH – Algoritmo (Linha 3) Quais as colunas apresentam entrada 2 pela primeira vez ? 4, 7 Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 1, 2, 3, PROBLEMAS: mais de um sítio ancestral ambíguo Procedimento FirstPath: flip + merge

43 43 PPH – Algoritmo (Linha 3) Quais as colunas apresentam entrada 2 pela primeira vez ? 4, 7 Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 1, 2, 3, First Path

44 44 PPH – Algoritmo (Linha 3) Quais as colunas apresentam entrada 2 pela primeira vez ? 4, 7 Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 1, 2, 3, First Path Não foi possível usar todas as arestas 1,2,3 e 6 no FirstPat, então é necessário crirar um SecondPath que contenha os vértices restantes e não possua interseção com FirstPah

45 45 PPH – Algoritmo (Linha 3) Quais as colunas apresentam entrada 2 pela primeira vez ? 4, 7 Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 1, 2, 3, First Path Second Path Identificar as sub- árvores que não fazem parte da solução e aplicar Merge

46 46 PPH – Algoritmo (Linha 3) Quais as colunas apresentam entrada 2 pela primeira vez ? 4, 7 Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 1, 2, 3, First Path Second Path

47 47 PPH – Algoritmo (Linha 3) Quais as colunas apresentam entrada 2 pela primeira vez ? 4, 7 Raiz

48 48 PPH – Algoritmo (Linha 4) Quais as colunas apresentam entrada 2 pela primeira vez ? NENHUMA Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 1,2,3,4 Tentar criar um ramo na árvore que contenha todos os nódos 1,2,3 e 4 (FirstPath) Aplicar Flip

49 49 PPH – Algoritmo (Linha 4) Quais as colunas apresentam entrada 2 pela primeira vez ? NENHUMA Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 1,2,3,4 O FirstPath usou todas os vértices 1,2,3 e 4 não sendo então necessário criar um SecondPath FirstPath

50 50 PPH – Algoritmo (Linha 5) Quais as colunas apresentam entrada 2 pela primeira vez ? NENHUMA Raiz Quais as colunas apresentam entrada 2 e anteriormente tb ? 2,5 Não necessita alterações na árvore, porque 2 e 5 estão no mesmo caminho

51 51 PPH – Algoritmo (resultado) Raiz

52 52 PPH – Algoritmo (resultado) Raiz

53 53 PPH – Algoritmo (extração da solução) Raiz

54 54 PPH – Algoritmo __________

55 55 PPH – Algoritmo __________

56 56 PPH – Algoritmo __________

57 57 PPH – Algoritmo __________

58 58 PPH – Algoritmo __________ Pontos de Evolução

59 59 PPH – Shadow Tree  Algoritmo em tempo linear no tamanho da matriz de genotypes;  Na teoria o melhor método já proposto;  Na prática a restrição de filogenia perfeita é muito forte e pouco realista;

60 60 Comparação Método de Clark: Método de Clark:  Resolve grandes quantidades de dados genotypes, entretanto não garante a melhor solução possível; Parcimônia Pura Parcimônia Pura  Garante a melhor solução possível, entretanto com um dispêndio de tempo e espaço alto; Filogenia Perfeita Filogenia Perfeita  Garante a melhor solução possível com tempo computacional excelente, entretanto restringe a entrada.

61 61 Outras Abordagens  NPPH - Near Perfect Phylogeny Haplotyping: permite uma relaxação da restrição de filogenia perfeita;  Máxima Verossimilhança: uma abordagem estatística;  Approximation algorithm for haplotype inference by maximum parsimony;


Carregar ppt "Métodos para Inferência de Haplotypes UNIVERSIDADE FEDERAL DE PERNAMBUCO."

Apresentações semelhantes


Anúncios Google