A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Biologia Molecular TRANSCRIÇÃO E TRADUÇÃO DE PROTEÍNAS EM PROCARIOTOS.

Apresentações semelhantes


Apresentação em tema: "Biologia Molecular TRANSCRIÇÃO E TRADUÇÃO DE PROTEÍNAS EM PROCARIOTOS."— Transcrição da apresentação:

1 Biologia Molecular TRANSCRIÇÃO E TRADUÇÃO DE PROTEÍNAS EM PROCARIOTOS

2 DNA DNA RNA ProteínaReplicaçãoTranscrição Tradução Trasncrição Reversa REVISANDO

3 Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na sequência de nucleotídeos de uma molécula de DNA de fita duplaÉ o processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na sequência de nucleotídeos de uma molécula de DNA de fita dupla

4 DOGMA

5 PROCARIOTO X EUCARIOTO

6 RNA -Fita Simples; -A,U,C,G; - Ribose

7 INÍCIOINÍCIO – quando ocorre reconhecimento de seqüência específica no DNA; ALONGAMENTOALONGAMENTO – quando os ribonucleotídeos são sucessivamente incorporados; TERMINAÇÃOTERMINAÇÃO – quando seqüências no DNA são reconhecidas e a síntese é interrompida. FASES DA TRANSCRIÇÃO

8 Fator (sigma) CoreHaloenzima RNA POLIMERASE

9

10 Fator sigma

11 FATOR SIGMA

12 Promotor Região Codificadora Terminador DNA RNA PROTEÍNA Ribossomo Estrutura de um Gene

13 T A T A A TRegião – 10: T A T A A T T T G A C ARegião – 35: T T G A C A As duas regiões são separadas por 17±1 nucleotídeos O primeiro nucleotídeo (+1) é geralmente uma purina (A ou G) CARACTERISTICAS DE UM PROMOTOR DE E. coli PROMOTOR A TTGACA...TATAATATCGATTTAGATCCCATGAT

14 PROMOTORES DE GENES BACTERIANOS

15 -10 9 nucleotídeos

16 TRANSCRIÇÃO

17 Reconhecer o promotor; Desnaturar o DNA expondo a seqüência a ser copiada; Manter as fitas de DNA separadas na região da síntese; Manter o híbrido DNA:RNA estável; Renaturar o DNA na região imediatamente posterior à síntese; Terminar a síntese do RNA. FUNÇÕES DA RNA POLIMERASE

18 TRANSCRIÇÃO

19

20

21 TÉRMINO DA TRANSCRIÇÃO Independente da proteína rho ( ) (90% dos casos) Dependente da proteína rho ( ) 5 CCCAGCCCGCCTAAGCGGGCTTTTTTTTGAC 3 3 GGGTCGGGCGGATTCGCCCGAAAAAAACTG 5 Pareamento A-U

22

23 ENZIMAS DE RESTRIÇÃO TRANSCRIÇÃO - RNAm

24 DNA fita codificadora DNA fita molde RNA transcrito

25 Código Genético e Sintese de Proteínas

26 É a relação entre a seqüência de bases no DNA e a seqüência de aminoácidos na proteína CÓDIGO GENÉTICO

27 UUU Phe UCU Ser UAU Tyr UGU Cys UUC Phe UCC Ser UAC Tyr UGC Cys UUA Leu UCA Ser UAA stop UGA stop UUG Leu UCG Ser UAG stop UGG Trp CUU Leu CCU Pro CAU His CGU Arg CUC Leu CCC Pro CAC His CGC Arg CUA Leu CCA Pro CAA Gln CGA Arg CUG Leu CCG Pro CAG Gln CGG Arg AUU Ile ACU Thr AAU Asn AGU Ser AUC Ile ACC Thr AAC Asn AGC Ser AUA Ile ACA Thr AAA Lys AGA Arg AUG Met ACG Thr AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GUC Val GCC Ala GAC Asp GGC Gly GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly CÓDIGO GENÉTICO

28 Características Pareamento códon:anticódon; Degeneração – um mesmo aminoácido pode ser codificado por vários códons diferentes; Não ambigüidade – cada códon corresponde a somente um aminoácido; Universalidade – o código genético é o mesmo nos mais diversos organismos (exceção: protozoários ciliados e mitocondiras); Utilização preferencial de códonsUtilização preferencial de códons (codon usage). CÓDIGO GENÉTICO

29

30 Consiste na transformação da mensagem contida no RNAm, via RNAt, na sequência de aminoácidos que constituem a proteína. Intervenientes: RNAm RNAt Ribossomas (RNAr) Aminoácidos Sistemas enzimáticos TRADUÇÃO

31 Procariotos –Subunidade 30S (rRNA 16S, 21 proteínas) –Subunidade 50S (rRNA 23S e 5S, 31 proteínas) Total 70S Eucariotos –Subunidade 40S (rRNA 18S) –Subunidade 60S (rRNA 28S, 5,8S e 5S) Total 80S ESTRUTURA DOS RIBOSSOMOS

32 Ribossomos ESTRUTURA DOS RIBOSSOMOS

33

34 tRNA - Estrutura secundária com grampos e alças formando um trevo -Alto número de bases modificadas depois da sua transcrição

35 tRNA

36

37

38 Existem 61 códons e 40 tRNAs. Como é resolvida a questão dos 21 códons restantes?

39

40 TrasncriçãoTradução

41 Etapas da tradução A síntese proteica ocorre em 3 etapas sucessivas: –1. Iniciação –2. Alongamento –3. Finalização

42 Sítio de ligação do ribossomo e códon de iniciação 5...AGGAGGxxxxxxxAUG...3 Códon de iniciação (raramente GUG ou UUG) RBS ou Seqüência Shine-Dalgarno RIBOSSOMAS

43 Início da tradução

44 Aminoacil- tRNA Aminoacil- tRNAsintetase Met-tRNA

45 INICIAÇÃO

46 Tradução ALONGAMENTO

47 Tradução ALONGAMENTO

48 TERMINAÇÃO

49 Antibióticos e Síntese Proteica Substância produzida por um organismo ou obtida sinteticamente que, em soluções diluídas, destrói as bactérias e outros microrganismos ou inibe o seu desenvolvimento. ANTIBIÓTICOS

50 Antibióticos e Síntese Proteica


Carregar ppt "Biologia Molecular TRANSCRIÇÃO E TRADUÇÃO DE PROTEÍNAS EM PROCARIOTOS."

Apresentações semelhantes


Anúncios Google