A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Suicídio e etilismo AVALIAÇÃO DAS CARACTERÍSTICAS CLÍNICAS, COMPORTAMENTO SUICIDA, IMPULSIVIDADE / AGRESSIVIDADE E SUAS ASSOCIAÇÕES COM POLIMORFISMOS DE.

Apresentações semelhantes


Apresentação em tema: "Suicídio e etilismo AVALIAÇÃO DAS CARACTERÍSTICAS CLÍNICAS, COMPORTAMENTO SUICIDA, IMPULSIVIDADE / AGRESSIVIDADE E SUAS ASSOCIAÇÕES COM POLIMORFISMOS DE."— Transcrição da apresentação:

1 Suicídio e etilismo AVALIAÇÃO DAS CARACTERÍSTICAS CLÍNICAS, COMPORTAMENTO SUICIDA, IMPULSIVIDADE / AGRESSIVIDADE E SUAS ASSOCIAÇÕES COM POLIMORFISMOS DE GENES LIGADOS ÀS FUNÇÕES SEROTONINÉRGICA E DOPAMINÉRGICA DE ETILISTAS Ana Luiza Garcia Cunha Orientador: Prof. Humberto Corrêa

2 Introdução Alcoolismo é uma doença crônica e progressiva caracterizada pela perda do controle sobre o uso de álcool, com conseqüências sociais, legais, psicológicas e físicas. Alcoolismo tipo I Alcoolismo tipo II início precoce, mais freqüentemente de outras drogas, mais alcoolismo e depressão entre seus parentes de primeiro grau maior determinismo genético e associação à impulsividade /agressividade e comportamento suicida.

3 Comportamento suicida refere-se à ocorrência de tentativas de suicídio, que são definidas como atos de agressão dirigidos a si mesmo com pelo menos alguma intenção de terminar com a própria vida.

4 Cerca de 15% dos alcoolistas vão se suicidar, enquanto 40% vão fazer pelo menos uma tentativa de suicídio. Nos EUA, no ano de hospitalizados em decorrência de tentativa de suicídio tratados em departamentos de emergência e liberados. 65% de todas as tentativas de suicídio estão associadas ao uso de álcool (Department of Health, 1993)

5 Estudos Genéticos Estudos história familiar, de gêmeos e de adoção - envolvimento genético. Candidatos: Sistema Serotoninérgico Sistema Dopaminérgico Baixos níveis de 5-HIAA no CSF em tentativas violentas impulsivas além de uma alta prevalência de desordens de personalidade e abuso de álcool entre esse subgrupo de pacientes. 5-HIAA – ácido 5-Hidroxiindoleacético CSF – Fluido Cérebro-espinhal

6 Mecanismos de produção, liberação e captação da Serotonina

7 Correlação entre os níveis de 5-HIAA no CSF e HVA (metabólito da via dopaminérgica) no CSF. O etanol estimula a transmissão dopaminérgica no sistema mesolímbico, especialmente o núcleo accumbens, onde há grande expressão do receptor de dopamina D3, em relação ao receptor D2. Lesão de terminais dopaminérgicos do núcleo accumbens pela neurotoxina 5-hidroxidopamina eliminam a auto-administração de cocaína papel significante na motivação para o uso de drogas, como cocaína, anfetamina e etanol. HVA - ácido homovanílico

8 Neurônios dopaminérgicos projetando da área tegmental ventral para o núcleo accumbens, tubérculo olfatório e septo, amigdala e hipocampo. Esse sistema mesolímbico dopaminérgico está envolvido em comportamentos baseados em emoções, incluindo motivação e recompensa.

9 Mecanismos de produção, liberação e captação da Dopamina

10 Objetivos do Estudo Avaliar diversos polimorfismos de genes envolvidos nas vias serotoninérgica e dopaminérgicas. Os alvos dessa pesquisa são os genes triptofano hidroxilase (TPH) catecol-O-metiltransferase (COMT) monoamino oxidase A e B (MAO A e MAO B) transportador de serotonina (5-HTT) receptores de serotonina – 5-HT1A, 5-HT2A, 5-HT2C, 5- HT1B receptor de dopamina D3.

11 Critérios de Seleção e Avaliação dos Pacientes Em abstinência Admitidos para tratamento psiquiátrico ambulatorial, na unidade de internação ou em hospital dia do IPSEMG, Características clínicas Parâmetros de impulsividade/agressividade História de tentativas de suicídio (letalidade, gravidade e tipo). Comparação dos escores de suicido, impulsividade / agressividade e outras características de personalidade. 100 pacientes e 100 controles

12 Transportador de Serotonina 5-HTT Localizado no cromossomo 17q11.1-q12 Esse gene codifica uma proteína integral de membrana que transporta o neurotransmissor serotonina da fenda sináptica para o neurônio pré-sináptico. Essa proteína é alvo de estimuladores psicomotores – como cocaína e anfetaminas.

13 Um polimorfismo comum (5- HTTLPR) é devido a uma deleção/inserção de 44 pares de bases (SS)/(LL) na região promotora 5 Esse polimorfismo afeta a taxa de recaptação de neurotransmissor. Alguns, mas não todos, estudos in vitro demonstraram que o alelo S tem um efeito dominante e diminui a transcrição ou a tradução do mRNA do 5-HTT Menor ligação de 5-HTT no córtex pré-frontal de vítimas de suicídio

14 Alelo S mais freqüentes entre pessoas que tentaram suicídio do que não dentro do mesmo diagnóstico psiquiátrico. LS e SS associados com suicídio violento, mas não com suicídio não-violento. Pacientes carregando o alelo S parecem ter pouco controle de características impulsivas e agressivas, e talvez tenham uma tendência a agir com métodos mais violentos no impulso para o suicídio ou violência.

15 Receptor D3 de Dopamina (DRD3) Cromossomo 3q13.3 O subtipo D3 inibe a adenilato-ciclase através de proteína G inibitória. DRD3 é expresso em regiões filogeneticamente antigas do cérebro, sugerindo um papel do receptor nas funções cognitivas e emocionais. Autoreceptores de dopamina inibem a síntese de dopamina, a liberação de dopamina e atividade elétrica dos neurônios dopaminérgico, mecanismos que são presumivelmente envolvidos em respostas comportamentais (como a inibição da atividade locomotora), com pequenas doses de agonistas.

16 Pré-tratamento de ratos: D3 agonistas o consumo de etanol. D3 antagonistas o consumo de etanol. Apesar disso, em um estudo com ratos nocaute para D3 e ratos C57 controle não achou-se diferença notável tanto no consumo quanto na preferência (3%/10%) de etanol.

17 Substituição de uma serina por uma glicina. O estudo de Gorwood et al não confirmou a ligação desse polimorfismo à dependência de álcool.

18 Outros genes a serem avaliados triptofano hidroxilase (TPH) catecol-O-metiltransferase (COMT) monoamino oxidase A e B (MAO A e MAO B) receptores de serotonina – 5-HT1A, 5-HT2A, 5-HT2C, 5-HT1B

19 Materiais e Métodos DNA genômico extraído à partir de sangue periférico dos participantes com base na técnica descrita por Boom et al, 1990.

20 PCR DRD3 primer F GCTCTATCTCCAACTCTCACA primer R AGGTCTACTCACCTCCAGGTA 5-HTTLPR primer F CCGCTCTGAATGCCAGCACCT AAC primer R AGAGGGACTGAGCTGGACAAC CAC

21 Reação – 5-HTTLPR 1Tubo 15,5 μL de água demineralizada e autoclavada 2,5 μL de tampão IIC 2,5 μL de dNTP 0,5 μL de primer F 0,5 μL de primer R 0,5 μL de Taq 3,0 μL de amostra de DNA

22 1- 95ºC por 5 minutos 2- 95ºC por 30 segundos 3- 64ºC por 1 minuto 4- 72º C por 1 minuto 5- Repetição do item 2 ao item 4 por 35 vezes 6- Extensão final a 72°C por 7 minutos 7- Manter a 4º por tempo indeterminado

23 Eletroforese – 5-HTTLPR

24 Reação – DRD3 1Tubo 19,168 μL de água 3,248 μL de dNTP 3,248 μL de buffer IB 0,652 μL do primer F 0,652 μL do primer R 0,652 μL Taq 1 μL de MgCl2 (25mM) 3,248 de DMSO 3,0 μL da amostra de DNA laborbedarf.de/images/12019.jpg

25 95ºC por 5 minutos 95ºC por 30 segundos 60ºC por 1 minuto 72ºC por 1 minuto para extensão das fitas Repetir, do ciclo 2 ao ciclo 5, por 35 vezes; Realizar uma última extensão a 72ºC por 7 minutos Resfriar a 4º C

26 Eletroforese 462bp

27 Digestão – DRD3 Enzima Msc 1 Sítios de corte TGGCCA e ACCGGT 37ºC por 4 horas; 65ºC por 20 minutos; 4º C / /98

28 Resultados 36 amostras 5- HTTLPR GenótipoFenótipo LL0,34 LS + SS0,66 51 amostras DRD3 GenótipoFenótipo Hetero0,53 Homo Ser0,33 Homo Gly0,13

29 28 amostras combinadas para DRD3 e 5-HTTLPR GenótipoFenótipo LL + Hetero0,214 SS + Hetero0,214 LS + Hetero0,214 LL + Homo Serina0,11 LS + Homo Serina0,07 SS + Homo Serina0,11 LL + Homo Glicina0,035 LS + Homo Glicina0 SS + Homo Glicina0,035

30 Observações Somente ao final do estudo serão consideradas as características de cada paciente e a sua correlação com o genótipo para que não haja indução na seleção dos pacientes por resultados preliminares. Todos os genes deverão ser avaliados para que se tenha uma visão ampliada dos fatores que podem estar influenciando no comportamento suicida entre os alcoolistas. Todas as amostras devem ser avaliadas para que se tenham um número estatisticamente mais válido para uma análise final.

31 Conclusões Uma influência genética é certa no comportamento suicida, mas as características ambientais e sociais não devem ser desconsideradas. Os sistemas serotoninérgico e dopaminérgico aparecem como candidatos a tal influência genética, mas ainda são necessários mais estudos para que se comprove que alterações nesses sistemas aumentam a susceptibilidade ao comportamento suicida associado ao alcoolismo para que, a partir desses dados, estratégias possam ser desenvolvidas no sentido de prevenir uma parte das ações suicidas.


Carregar ppt "Suicídio e etilismo AVALIAÇÃO DAS CARACTERÍSTICAS CLÍNICAS, COMPORTAMENTO SUICIDA, IMPULSIVIDADE / AGRESSIVIDADE E SUAS ASSOCIAÇÕES COM POLIMORFISMOS DE."

Apresentações semelhantes


Anúncios Google