A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Laboratório de Genoma Funcional Centro de Biologia Molecular e Engenharia Genética Departamento de Genética e Evolução – IB UNICAMP

Apresentações semelhantes


Apresentação em tema: "Laboratório de Genoma Funcional Centro de Biologia Molecular e Engenharia Genética Departamento de Genética e Evolução – IB UNICAMP"— Transcrição da apresentação:

1 Laboratório de Genoma Funcional Centro de Biologia Molecular e Engenharia Genética Departamento de Genética e Evolução – IB UNICAMP Marcelo Menossi UNICAMP O DNA recombinante

2 Problema: Como produzir hormônio de crescimento humano em milho ?

3 DNA recombinante Stanley Cohen Stanford University Herbert W. Boyer USFC

4 Questões iniciais 1. Qual é o produto? Planta transgênica de milho que produza hormônio de crescimento 2. Alguém já fez isso? Busca em revistas científicas e banco de patentes 3. Viabilidade econômica, custos de produção, mercado, etc... Entenda a importância do assunto e consulte especialistas 4. Como montar o gene recombinante? - como obter a região codificante? - em qual parte da planta será expresso? - sistema de purificação? - biossegurança? 0. O laboratório tem Certificado de Qualidade em Biossegurança? Obedecer a legislação brasileira !

5 DNA célulasnúcleocromossomos DNA organismo

6 Dogma central da biologia molecular Animação: Carnegie Mellon

7 Dogma central da biologia molecular DNA: Armazena informação RNA: intermediário da informação do DNA Proteína: Realiza as tarefas das células

8 O gene promotorcodificante terminadora Onde: folha raiz Quando: início germinação ataque inseto Quanto: muito, pouco. O que: proteína bactericida absorção de Fe síntese açúcar Final do gene...ATCGTGATATACTAGACGATGCATGACCACCCAACTGAACTGTAACTTTAAC...

9 DNA recombinante ou transgene PromotorhGH Terminador 4. Como montar o gene recombinante? - como obter a região codificante? - em qual parte da planta será expresso? - sistema de purificação? - biossegurança?

10 Como obter a região codificante ? Alternativa menos complexa: busque em banco de dados. NCBI: milhões de seqüências de DNA e proteínas genomas !

11 Seqüência codificante (CDS) Hormônio crescimento humano

12 CDS: homônio crescimento humano O ATG iniciador e o TAG de parada estão indicados em vermelho. Eles delimitam a CDS.

13 Promotor Região codificadora Região terminadora ExonIntron RNA pol II Fatores de transcrição Transcrito primário Em alguns tecidos ocorre ligação de fatores de transcrição, que ativam a RNA pol II Na transcrição a RNA pol II produz o transcrito primário do RNA RNA mensageiro No processamento o transcrito primário é modificado por enzimas, que removem os introns, adicionam o cap na extremidade 5 e a cauda poli-A na extremidade 3 Na tradução, o mRNA é lido pelos ribossomos, iniciando a produção da proteína no AUG e terminando em um códon de parada (STOP) AAAAAAA (n) AUGSTOP Líder (transcrito, não taduzido) Transcrição

14 mRNA Projeto Genoma EST: obtenção de cDNA Diversos tipos celulares Flor, raiz, colmo Extração RNA 2- Produção de cDNA cDNA

15 Como separar os cDNAs dos distintos genes? Solução aquosa contendo os cDNAs em um tubo de 1.5 ml

16 Plasmídeos Pequenos cromossomos circulares de bactérias

17 Gene de interesse Cromossomos circulares, fita dupla de DNA que replicam de forma independente do ciclo celular. Tamanho varia de poucos kb a ~100 kb Insertos de até 10 kb Têm origem de replicação, gene de resistência a antibiótico e sítio múltiplo de clonagem (vários sítios de enzimas de restrição) Várias cópias por célula Bactéria contendo um plasmídeo pode ser armazenada indefinidademente a -70oC em solução com 15% glicerol DNA plasmidial é facilmente isolado de culturas celulares. Vetores plasmidiais

18 Sítio múltiplo de clonagem Gene de interesse Enzima 1 Enzima 2

19 A ligação pode ocorrer entre DNA distintos Extremidades coesivas

20 Extremidades abruptas (blunt ends)

21 DNA ligases: reparam DNA quebrado

22 Como ligar extremidades não compatíveis? Klenow fragment: atividade DNA polymerase 5 -> 3 e exonuclease 3' -> 5' Preenchimento extremidades 5' de DNA Digestão de extremidades 3' de DNA T4 DNA polimerase é 200 x mais ativa para este fim

23 Como separar os cDNAs dos distintos genes? Solução aquosa contendo os cDNAs em um tubo de 1.5 ml

24 Clonagem do GOI no vetor de expressão morpheus.fmrp.usp.br/td/files/apostilaTD_2003.doc

25 Plasmídeo bacteriano "aberto" cDNA (ESTs) + Enzima T4 DNA ligase Coleção de cDNAs clonados. Clonagem dos cDNAs gene resistência antibiótico

26 amp R + Bactéria Eletroporação Biblioteca de cDNA Transformação de bactérias Este e o próximo slide foram inseridos para detalhar a transformação de bactérias com os plasmídeos contendo os ESTs. *não* mostrados em aula

27 Plaqueamento em meio com agente seletivo Incubação a 37ºC para a síntese de b-lactamase pelo gene ampR Formação de colônias contendo plasmídeos Biblioteca de cDNA Seleção das bactérias com plasmídeos

28 Plaqueamento de uma biblioteca de cDNA

29 Algoritmo Blastx Inferência da função da proteína Tradução das 6 possíveis frames e comparação com proteínas depositadas em bancos de dados >SCCCLR1076G12.g CCCATTTGTCTCGTCTCGCTCTCACGCTCGCGTCACCGG AGCTCTCCAGAAGCGAGCCCCAACTGCCCAAGGGCGAGC GATCCGATCCCCTTCGCGGCCTCGTCAACGACGCCGAGA ACACTTTGAGGAATGGCTGAAGAGGATGTCCAGCCCCTT GTGTGTGACAATGGCACTGGAATGGTCAAGGCGGGTTTC GCTGGTGACGATGCACCGAGAGCTGTCTTTCCTAGCATT GTAGGCAGGCCACGCCACACTGGTGTGATGGTGGGCATG GGTCAAAAGGATGCATATGTGGGCGATGAAGCTCAGTCC AAAAGAGGTATTCTGACACTGAAGTACCCAATCGAGCAC GGCATTGTCGGCAACTGGGATGATATGGAGAAGATCTGG CACCACACCTTCTACAATGAGCTTCGTGTGGCACCTGAG GAGCACCCTATACTGCTGACCGAGGCTCCTCTGAACCCC AAGGCAAACAGGGAGAAGATGACCCAGATTATGTTCGAG ACGTTCAACTGCCCGGCAATGTATGTGGCCATCCAGGCC GTTCTTTCCCTGTACGCCAGTGGTCGAACAACTGGTATT GTGCTCGACTCTGGTGATGGTGTGAGCCACACTGTCCCC ATCTACGAAGGGTACACGCTTCCTCATGCTATTCTTCGA TTGGACCTTGCTGGTCGTGACCTTACCGACAACCTGATG AAGATCCTTACTGAGAGGGGTTACTCCTTCACCACAACT GCCGAGCGAGAAATTGTCAGGGACATCAAGGAAAAACTT GCCTACGTTGCCCTTGATTATGAACAGGAGCTGGAGACT GCCAGGACCAGCTCCACCATTGAGAAGAGCTACGAGCTA CCCGATGGCCAGGTTATCACAATCGGTGCAGAAAGGTTT AGG

30 Biblioteca de cDNA Delimitar os tecidos que cujos transcritomas serão amostrados Sangue, cérebro, fígado, etc Extrair RNA Gerar DNA complementar (cDNA) com transcritase reversa Clonar em plasmídeos Transferir para bactéria (normalmente E. coli) Amplificar o DNA plasmidial Seqüenciar Avaliar similaridade da proteína deduzida com bancos de dados Organizar informações do genoma em banco de dados

31 5 GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT 3 AAAAAAAAAAAAAAA 3 TTTTTTTTTTTTTTTCCCGCCGGCG...CAG 5 AAAAAAAAAAAAAAA TTTTTTTTTTTTTTTCCCGCCGGCG...CAG 5 AAAAAAAAAAAAAAAGGGCGGCCGC GTC TTTTTTTTTTTTTTTCCCGCCGGCG...CAG 5 TCGACCCACGCGTCCG GGGTGCGCAGGC AAAAAAAAAAAAAAAGGGCGGCCGC GTC TTTTTTTTTTTTTTTCCCGCCGGCG...CAG 5 TCGACCCACGCGTCCG GGGTGCGCAGGC AAAAAAAAAAAAAAAGGGC TTTTTTTTTTTTTTTCCCGCCGG Primer para síntese de cDNA (Not I adapter): mRNA Síntese primeria fita de DNA com transcritase reversa mRNA cDNA Síntese segunda fita de DNA com RNAse H, DNA polimerase e Ligase Ligação do Adaptador Sal I Digestão com Not I AUG STOP ATGSTOPAAAA TACSTOPTTTT 5 TCGA CCGG 35 3

32 Vetores plasmidiais Gene de interesse

33 pSC101: primeiro plasmídeo Stanley Cohen Herbert Boyer Construction of biologically functional bacterial plasmids in-vitro. (1973) COHEN SN, CHANG ACY, BOYER HW, HELLING RB. Proc. Natl. Acad. Sci. USA: 70:

34 Problema: produção de hormônio de crescimento humano em milho Identificar o gene de humanos que codifica o hormônio de crescimento Montar um cassete de expressão que seja ativo em milho Produzir grandes quantidades do DNA Obter uma planta transgênica Purificar a proteína

35 Plasmídeo com o gene do hGH em mãos gene resistência antibiótico hGH

36 CDS: homônio crescimento humano O ATG iniciador e o TAG de parada estão indicados em vermelho. Eles delimitam a CDS.

37 Em qual parte do milho o gene humano deve ser ativo ?

38 A Semente de Milho Fonte: Adilson Leite

39

40 Construção do gene quimérico promotorcodificante terminadora Onde: endosperma Quando: desenvolvimento da semente Quanto: muito O que: hGH Final do gene...ATCGTGATATACTAGACGATGCATGACCACCCAACTGAACTGTAACTTTAAC...

41 Como clonar o promotor? A.Buscar em publicações promotores com padrão desejado Ou B. Clonar um novo promotor: 1.Identificar RNA (transcrito) que se acumula no tecido desejado 2.Clonar o promotor: Busca em banco de dados Genome walking Screening de bibliotecas genômicas

42 Bibliotecas genômicas Vetores especiais: Cosmídeos: kb de inserto Cromossomos artificais de bactéria (BACs): até 300 kb

43 DNA do BAC A ligado na membrana de náilon TCAGTTCAGT 32 P DNA do BAC B ligado na membrana de náilon Gene é marcado com radioatividade Detecção de ácidos nucléicos – Southern blot

44 A D G W M BACs que acendem: tem o gene de interesse Sequenciamento do BAC e identificação do promotor Ensaio funcional do possível promotor (próximas aulas) Detecção do sinal radioativo

45 Estratégia alternativa: genomewalker

46 Cassete de expressão em sementes hGH P kaf Leite, A.; Arruda, P.; El-Dorry, H.; Kemper, E.; da Silva, M.J. Desenvolvimento de um cassete de expressão de proteínas heterólogas especificamente em sementes de plantas transgênicas. Pedido de Patente – INPI: PI Promotor de sorgo, ativo em sementes de milho Gene humano Terminadora de bactéria

47 Software para construções de DNA recombinante pDraw32

48 Sistema Gateway (Invitrogen)

49 attL1 Gene attL2 Km R Entry Clone ccdB attR1 attR2 Amp R Destination Vector LR Clonase attL1 x attR1 attP1 attB1 Gene attL2 attR2 ccdB Cointegrado

50 Sistema Gateway (Invitrogen) LR Clonase Gene Amp Expression Clone attB1 attB2 ccdB Km By- Product attP1 attP2 attL2 x attR2 attP1 attB1 Gene attL2 attR2 ccdB Cointegrado

51 Gene 2-Hybrid Gene T7- E. coli Gene ViraPower Gene Your Vector Gene Baculovirus Gene CMV-Neo Gene RNAi Gene IVTT Vetores para as mais diversas finalidades CAT gene


Carregar ppt "Laboratório de Genoma Funcional Centro de Biologia Molecular e Engenharia Genética Departamento de Genética e Evolução – IB UNICAMP"

Apresentações semelhantes


Anúncios Google