A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

ÁCIDOS NUCLÉICOS DNA RNA ÁCIDOS NUCLÉICOS O DNA.

Apresentações semelhantes


Apresentação em tema: "ÁCIDOS NUCLÉICOS DNA RNA ÁCIDOS NUCLÉICOS O DNA."— Transcrição da apresentação:

1

2 ÁCIDOS NUCLÉICOS DNA RNA

3 ÁCIDOS NUCLÉICOS O DNA

4 Constituintes: Nucleotídeos: formados por três diferentes tipos de moléculas: um açúcar (pentose): desoxirribose no DNA e ribose no RNA. um grupo fosfato. uma base nitrogenada. Nucleotídeo de DNA Nucleotídeo de RNA OBS.: A molécula sem o grupo fosfato é chamada nucleosídeo.

5 Nucleotídeos Base nitrogenada + Pentose + Fosfato Nucleosídeo = Base nitrogenada + Pentose

6 As pentoses

7 Nucleotídeos Base nitrogenadas Pirimidina: Timina, Uracil e Citosina Purina: Adenina e Guanina

8

9 DNA – Molécula: Consiste de duas cadeias (fitas) helicoidais polinucleotídicas, enroladas ao longo de um mesmo eixo, formando uma dupla hélice de sentido rotacional à direita: dextrógera. Na dupla hélice as duas fitas de DNA são complementares (A = T e G = C) e apresentam polaridades opostas: antiparalelas:. polaridade 5. 3 em uma fita e 3. 5 na outra. Grupo fosfato e desoxirribose (parte hidrofílica): localizados na parte externa da molécula. Bases nitrogenadas (parte hidrofóbica): empilhadas dentro da dupla hélice,com suas estruturas hidrofóbicas de anéis quase planos muito próximos e perpendiculares ao eixo da hélice. Está presente no núcleo das células eucarióticas, nas mitocôndrias e nos cloroplastos, e no citosol das células procarióticas. Nas células germinativas e no ovo fertilizado, dirige todo o desenvolvimento do organismo, a partir da informação contida em sua estrutura. É duplicado cada vez que a célula somática se divide

10 DNA – Molécula:.

11 DNA - Regra de Chargaff: Erwin Chargaff (1950): técnica para medir a quantidade de cada tipo de base no DNA de diferentes espécies. Seus dados mostraram que:. quantidade relativa de um dado nucleotídeo pode ser diferente entre as espécies, mas sempre A = T e G = C.. razão 1:1 entre bases púricas e pirimídicas em todos os organismos estudados: A + G = T + C.. quantidade relativa de cada par AT ou GC pode variar bastante de organismo para organismo: razão A+T/G+C é característica da espécie analisada.

12 DNA - Pareamento de Bases: Bases são complementares. A = T ® 2 pontes de hidrogênio G º C ® 3 pontes de hidrogênio G º C É MAIS ESTÁVEL

13 Replicação do DNA Watson e Crick: postulado teórico (não testado experimentalmente): replicação semi-conservativa Meselson e Stahl: confirmam, através de experimentação, a hipótese feita por Watson e Crick de que o DNA se replica de maneira semiconservativa.

14 Replicação do DNA: Necessidade de fita molde. Ocorre na fase S da interfase. DNA polimerase: adição de nucleotídeos no sentido 5. 3: necessidade de extremidade 3-OH livre para que ocorra a ligação fosfodiéster. Necessidade de um iniciador ouprimer : oligonucleotídeo de RNA, complementar ao DNA fita-molde. - Após adição de um nucleotídeo, a DNA polimerase se dissocia ou se move ao longo do molde para adicionar um outro nucleotídeo: DNA ligase: no final da síntese, a polimerase remove os iniciadores e os substitui por nucleotídeos de DNA Æ cortes selados pela DNA ligase.

15

16 ENZIMAS MAIS IMPORTANTES DA REPLICAÇÃO DO DNA HELICASE GIRASE PRIMASE DNA POLIMERASE I,II,III LIGASE

17 PARA QUE O DNA SE REPLICA?

18 PROPRIEDADES DO DNA TRANSCRIÇÃO TRADUÇÃO MUTAÇÃO

19 TRANSCRIÇÃO

20

21 RNA - Molécula Tipos: mRNAs (RNAs mensageiros): veículo pelo qual a informação genética é transferida do DNA aos ribossomos para a síntese de cadeias polipeptídicas. rRNAs (RNAs ribossômicos): componentes estruturais dos ribossomos - catalisam a tradução de um mRNA em uma cadeia polipeptídica. tRNAs (RNA transportador ou de transferência): moléculas adaptadoras que traduzem a informação presente no mRNA em uma seqüência específica de aminoácidos.

22 EDITORAÇÃO DO RNA

23 O Dogma Central da Biologia Molecular:

24

25 O CÓDIGO GENÉTICO

26 POR QUE O CÓDIGO GENÉTICO É DE TRÊS LETRAS?

27 TRADUÇÃO

28 A tabela abaixo representa uma versão fictícia(de brincadeira) do código genético. Entretanto, esse código segue o padrão do código genético universal, no qual três bases codificam um aminoácido. Trinca de bases Aminoácido Trinca de bases Aminoácido AAC Ã Ã CUAC AGGAGAAP AUCAGCCO AUGiniciaçãoGCUL CAUNUAAterminação CCUEUAUV CGAVUCGI CGCAAGAM Analise a tabela e faça o que se pede: 01. Cite o nome da enzima que catalisa a síntese de RNA mensageiro. 02. Cite a seqüência do anticódon correspondente ao códon de iniciação. 03. Qual a seqüência de aminoácidos que resultará da tradução da seguinte molécula de RNA mensageiro? Utilize a tabela do código genético fictício. 5 3 AUAUGCGAUCGGCUAUCCAUGCCUAUAGGCUACGCAGAGAACCUAACGCCUAA Obs. Apesar da molécula de RNAm codificar um pequeno polipeptídeo utilize o códon de início e de término.


Carregar ppt "ÁCIDOS NUCLÉICOS DNA RNA ÁCIDOS NUCLÉICOS O DNA."

Apresentações semelhantes


Anúncios Google