A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Apresentações semelhantes


Apresentação em tema: "PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers."— Transcrição da apresentação:

1

2 PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated times so that the DNA between the primers is amplified

3 The first PCR cycle: The sequence between the two primers will be amplified

4 Four cycles of PCR

5 Copy number of the sequence between the primers increases exponentially

6 SEQUENCIAMENTO DE DNA Profa. Dra. Maria Aparecida Fernandez Depto de Biologia Celular e Genética Universidade Estadual de Maringá

7 Structure of dideoxynucleotide triphosphates

8 Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist DNAP requires a template and a primer The [ddNTP] determines the distribution of chain lengths produced. The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.

9

10 TGGCTCGGCCTCAAGTCGAG GTTATCAGATCTGCAACTCAA Alto peso molecular Baixo peso molecular Filme de raio X Auto-radiogramaLeitura manual

11 Automated DNA Sequencing

12 Reação de seqüênciamento

13 Fragmentos amplificados na reação de seqüênciamento

14 Typical output of an automated sequencer

15 Eletroforese no seqüênciamento

16

17 Captura do fluorescente e processamento da informação

18

19

20 Seqüenciador automático

21

22

23

24

25

26

27

28

29 Conjunto de 16 capilares

30

31

32

33

34 Panorama no momento da corrida

35 Análise preliminar pós corrida

36 ELETROFEROGRAMAS


Carregar ppt "PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers."

Apresentações semelhantes


Anúncios Google