PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated times so that the DNA between the primers is amplified
The first PCR cycle: The sequence between the two primers will be amplified
Four cycles of PCR
Copy number of the sequence between the primers increases exponentially
SEQUENCIAMENTO DE DNA Profa. Dra. Maria Aparecida Fernandez Depto de Biologia Celular e Genética Universidade Estadual de Maringá
Structure of dideoxynucleotide triphosphates
Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist DNAP requires a template and a primer The [ddNTP] determines the distribution of chain lengths produced. The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.
TGGCTCGGCCTCAAGTCGAG GTTATCAGATCTGCAACTCAA Alto peso molecular Baixo peso molecular Filme de raio X Auto-radiogramaLeitura manual
Automated DNA Sequencing
Reação de seqüênciamento
Fragmentos amplificados na reação de seqüênciamento
Typical output of an automated sequencer
Eletroforese no seqüênciamento
Captura do fluorescente e processamento da informação
Seqüenciador automático
Conjunto de 16 capilares
Panorama no momento da corrida
Análise preliminar pós corrida
ELETROFEROGRAMAS