A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

1 Professores: Admir J. Giachini Andrea de Lima Pimenta Daniel Santos Mansur.

Apresentações semelhantes

Apresentação em tema: "1 Professores: Admir J. Giachini Andrea de Lima Pimenta Daniel Santos Mansur."— Transcrição da apresentação:

1 1 Professores: Admir J. Giachini Andrea de Lima Pimenta Daniel Santos Mansur

2 Grupos de seminários (02/12/2013) 25 min apresentação e 15 min discussão Margareth, Thays, Manuel, Rodolfo, Maíra (08:00-08:40) Artigo: Molecular Bacteria-Fungi Interactions Ana Carolina, Danielle, Vânia, Francisco, Roniele (08:40-09:20) Artigo: Strategies for mining fungal products Ana Paula M, Mariana M, Victor, Elmahdy, Vagner (09:20-10:00) Artigo: Poxyviruses and host antiviral defenses Anabel, Mariana R, Renato, Ana Paula G, Marília (10:20-11:00) Artigo: Reprogramming microbes to be pathogen-seeking killers Bianca, Iris, Roberta, Luana, Greicy (11:00-11:40) Artigo: Small molecules disassembling biofilms 2

3 Biogênese: Omne vivum ex vivo (Pasteur, 1864) 3 Origem da vida na terra - biogênese

4 Áreas que estudam a biogênese Astrofísica Cosmoquímica Planetologia Biologia evolutiva Paleobioquímica 4 Origem da vida na terra - biogênese

5 A idade dos mitos Deuses que por invocação criaram a terra, a água, as coisas, etc. Vida vinda da água, que rodeava a terra, que era rodeada pelo céu e juntos formavam o cosmos 5 Origem da vida na terra - biogênese

6 Período medieval Teoria da geração espontânea Século XVII: Buffon e Needham x Spallanzani 6 Origem da vida na terra - biogênese

7 Progresso histórico - Comte (1798-1857) Estágio 1: período teológico e mitológico – realidade descrita como resultado de forças sobrenaturais (politeísmo, monoteísmo, animismo) Estágio 2: idade da metafísica – seres sobrenaturais (deuses) são substituídos por termos abstratos, poderes ou entidades Estágio 3: idade científica ou do positivismo – unificação da teoria e prática que é fruto do pensamento racional e da observação nos permitindo reconhecer relações e similaridades 7 Origem da vida na terra - biogênese

8 Estágio 3 Alexander Ivanovich Oparin (1894-1980) Oparin: Bakh Institute of Biochemistry in Moscow Hipóteses de Oparin Biogênese como discussão científica 8 Origem da vida na terra - biogênese http://www.valencia.edu/~orilife/textos/Th e%20Origin%20of%20Life.pdf

9 Surgimento da vida na terra Atmosfera primitiva – redutora ou oxidativa? Redutora: a terra coalescendo devagar, gerando pouco calor, o Fe exposto na superfície capturaria todo o oxigênio molecular. Assim, a atmosfera primitiva seria basicamente constituída de H 2 O, H 2, N, NH 3, CH 4 com pouco CO ou CO 2 (Oparin, 1924 – Oparin e Haldane) Ligeiramente oxidativa: a terra coalescendo rápido, gerando muito calor, a maioria do Fe derreteria e escorreria para o centro da terra, permitindo com que o O 2 combinasse com CO 2. Assim, a atmosfera primitiva seria constituída basicamente de H 2 O, CO e CO 2, com traços de N, SO 3 2-, NH 3, CH 4 e pouco O 2 9

10 Surgimento da vida na terra Atmosfera primitiva – redutora Terra sujeita a várias fontes de energia (descargas elétricas, radiação solar, calor de vulcões, etc.) Essas fontes de E propiciaram a formação de pequenas moléculas orgânicas As substâncias químicas se acumularam na hidrosfera, o que então se tornou uma sopa diluída a partir da qual as primeiras formas vivas evoluíram espontaneamente 10

11 Surgimento da vida na terra Água na terra: s urgiu a ± 4 bilhões de anos, demonstrado pela presença de rochas sedimentares (3,8 bilhões de anos) na Groelândia, que requerem água para se formar Primeiramente expelida por vulcões, expandiu e se resfriou, e então se condensou e caiu na forma de chuva 11

12 Surgimento da vida na terra Água na terra: s urgiu a ± 4 bilhões de anos, demonstrado pela presença de rochas sedimentares (3,8 bilhões de anos) na Groelândia, que requerem água para se formar A elevada temperatura da crosta da terra fez com que a água da chuva evaporasse antes de tocar o solo, resultando em ciclos contínuos de expansão, resfriamento, condensação e chuva, iniciando o ciclo da água 12

13 Surgimento da vida na terra Água na terra: s urgiu a ± 4 bilhões de anos, demonstrado pela presença de rochas sedimentares (3,8 bilhões de anos) na Groelândia, que requerem água para se formar Essa água vagarosamente esfriou a superfície da terra, permitindo com que gotas se formassem, dando origem a pequenas poças, fontes, lagos, rios e oceanos 13

14 Surgimento da vida na terra Água na terra: s urgiu a ± 4 bilhões de anos, demonstrado pela presença de rochas sedimentares (3,8 bilhões de anos) na Groelândia, que requerem água para se formar Considerando que a água era acídica (CO 2, SO 2, etc.), a água dissolveu a porção granítica da superfície basáltica liberando sal para salinização e formação dos oceanos 14

15 Origem da vida na terra - biogênese A ± 4,5 bilhões de anos a terra era um lugar inospitável 15 http://en.wikipedia.org

16 Cerca de 1 bilhão de anos mais tarde apareceram os primeiros organismos capazes de metabolizar (capacidade de acumular e modificar nutrientes e energia) e de reproduzir-se (capacidade de gerar indivíduos como eles) provavelmente anaeróbios termofílicos (como geravam energia?) Como eles chegaram aqui? 16 Origem da vida na terra - biogênese

17 Teoria criacionista Antes do século XVII a maioria das pessoas acreditava que Deus criou o homem e que outras criaturas menores fossem criadas via geração espontânea a partir da MO em decomposição 17 http://quiprona.wordpress.com/2011/01/29/o-ensino-da-teoria-da-evolucao-e-a-ficha-que-ainda-nao-caiu/ Teorias sobre a biogênese

18 A sopa primordial: propõe que os primeiros organismos eram organotróficos termofílicos anaeróbios (como a maioria dos fermentadores) que obtinham tanto energia quanto o carbono de compostos orgânicos Reações químicas formaram ácidos graxos, açúcares, aminoácidos, purinas, pirimidinas, nucleotídeos, e polímeros (± 4,1 Ba) quando a atmosfera foi exposta a descargas elétricas e radiação UV Acúmulo de compostos gerou os primeiros nichos de vida na terra Agregação espontânea de lipídios e proteínas (3,9 Ba) propiciou a formação de membranas primitivas e internamente incorporada a combinação certa de componentes químicos orgânicos e inorgânicos – mas não na forma de coacervados como se pensava anteriormente (Oparin 1936) 18

19 Miller-Urey (University of Chicago) nos anos 50, recriaram, num balão, como teria sido a formação das reações químicas responsáveis pela criação da vida – água, CH 4, NH 3, H 2, descargas elétricas, produzindo moléculas como formaldeído (CH 2 O ou HCHO) e cianeto de hidrogênio (HCN), precursores da glicina 19 http://www.goldiesroom.org/Note%20Packets/21%20Evolution/00%20Evolution--WHOLE.htm Teorias sobre a biogênese

20 Miller-Urey (University of Chicago) nos anos 50, recriaram, num balão, como teria sido a formação das reações químicas responsáveis pela criação da vida – água, CH 4, NH 3, H 2, descargas elétricas, produzindo moléculas como formaldeído (CH 2 O ou HCHO) e cianeto de hidrogênio (HCN), precursores da glicina 20 Miller, Stanley L. (May 1953). "Production of Amino Acids Under Possible Primitive Earth Conditions" (PDF). Science 117(3046): 528– 9. Bibcode 1953Sci...117..528M.doi:10.1126/science.117.3046.528. PMID 1 3056598."Production of Amino Acids Under Possible Primitive Earth Conditions"ScienceBibcode1953Sci...117..528Mdoi10.1126/science.117.3046.528PMID1 3056598 Miller, Stanley L.; Harold C. Urey (July 1959). "Organic Compound Synthesis on the Primitive Earth". Science 130(3370): 245– 51. Bibcode 1959Sci...130..245M.doi:10.1126/science.130.3370.245. PMID 13668555. Miller states that he made "A more complete analysis of the products" in the 1953 experiment, listing additional results.ScienceBibcode1959Sci...130..245Mdoi10.1126/science.130.3370.245PMID 13668555 Teorias sobre a biogênese

21 Miller-Urey (University of Chicago) CO 2 CO + [O] (atomic oxygen) CH 4 + 2[O] CH 2 O + H 2 O CO + NH 3 HCN + H 2 O CH 4 + NH 3 HCN + 3H 2 Formaldeido (CH 2 O), ammonia e cianeto de H (HCN) reagem formando: CH 2 O + HCN + NH 3 NH 2 -CH 2 -CN + H 2 O NH 2 -CH 2 -CN + 2H 2 O NH 3 + NH 2 -CH 2 -COOH (glicina) 21 Teorias sobre a biogênese

22 Mesma condição em meteoro encontrado na Austrália e também no espaço sideral - 90 aa diferentes (19 deles encontrados na terra) Meteoritos carbonáceos também têm Adenina (HCN) 5 e Guanina (HCN) 5 O Onde nascem as estrelas há uma abundância de H 2 O, NH 3, CH 2 O e HCN, compostos da sopa primordial Essa situação só seria possível numa atmosfera redutora, e não oxidativa como é hoje Hipóteses mais recentes duvidam da atmosfera redutora da terra mas mostram que o H constituía cerca de 40 % dos gases terrestres (o sol é basicamente composto de H) 22 Teorias sobre a biogênese

23 Teoria do mundo de RNA Walter Gilbert, da Harvard University, em 1986, sugeriu que tudo se originou a partir de um precursor de RNA – o mundo do RNA, onde essa molécula catalisou todas as reações necessárias para que o último ancestral comum sobrevivesse e se replicasse Gilbert, W. (1986). "Origin of life: The RNA world". Nature 319 (6055): 618. Teorias sobre a biogênese

24 Teoria do mundo de RNA Na verdade essa hipótese foi primeiro sugerida por Carl Woese (Univeristy of Illinois) na década de 60, e mais tarde também adotada por Francis Crick (Medical Research Council in England) e Leslie Orgel (Salk Institute in San Diego) 24 Carl Woese http://www.astrobio.net/amee/summer_2008/Interviews/An thonyPooleInterview.php Francis Crick http://estudante-de-biogeo- 11.blogspot.com/2008_10_01_archive.html Leslie Orgel http://www.nytimes.com/2007/11/05/us/05orgel.html Teorias sobre a biogênese

25 Teoria do mundo de RNA No entanto, quem tenta explicar essa teoria encontra um paradoxo Qual é esse paradoxo? 25 Teorias sobre a biogênese

26 Teoria do mundo de RNA No entanto, quem tenta explicar essa teoria encontra um paradoxo Ácidos nucléicos somente são sintetizados com o auxilio de proteínas Proteínas somente são sintetizadas se a sequência de nucleotídeos correspondente estiver presente 26 Teorias sobre a biogênese

27 Teoria do mundo de RNA No entanto, quem tenta explicar essa teoria encontra um paradoxo É muito improvável que ambas originaram-se espontaneamente no mesmo lugar e ao mesmo tempo É muito improvável que um tenha sido gerado sem a presença do outro Isso gera indícios que, aparentemente, a vida não poderia ter sido gerada através de simples reações químicas 27 Teorias sobre a biogênese

28 Teoria do mundo de RNA Esse RNA teria, subsequentemente, a habilidade de ligar aminoácidos para formar proteínas Esse cenário só é possível se o RNA prebiótico tivesse 2 condições que não são evidentes hoje: A capacidade de se replicar sem o auxílio de proteínas Habilidade de catalisar cada passo da síntese de proteínas 28 Teorias sobre a biogênese

29 Teoria do mundo de RNA A descoberta de ribozimas, enzimas de RNA, em trabalhos independentes em duas universidades dos EUA nos anos 80 deu credibilidade para essa teoria Essas ribozimas conseguem ligar nucleotídeos, como se faz na síntese de RNA ou DNA Leva a indícios de que, dessa forma, existiu um ancestral comum as formas de vida, dando suporte a teorização do mundo de RNA 29 Teorias sobre a biogênese

30 Teoria do mundo de RNA Como explicar a questão de existir um ancestral comum? 30 Teorias sobre a biogênese

31 Teoria do mundo de RNA Como explicar a questão de existir um ancestral comum? Coisas vivas consistem de compostos orgânicos similares (ricos em C) Roll de proteínas sintetizadas a partir de 20 aminoácidos Essas proteínas incluem enzimas essências ao desenvolvimento, sobrevivência e reprodução Organismos contemporâneos carregam sua informação genética em ácidos nucleicos (DNA e RNA) e usam o mesmo código genético Esse código genético define o roll de aminoácidos, proteínas e o funcionamento do organismo Dessa forma a questão muda para: que série de reações químicas criou esse sistema interdependente de ácidos nucleicos e proteínas? 31 Teorias sobre a biogênese

32 Teoria do mundo de RNA Problemas com esse modelo: A síntese de proteínas de forma independente (explicada anteriormente) Baixa concentração dos constituintes iniciais para síntese da molécula Instabilidade das riboses: dentre os carboidratos é uma das mais instáveis (73´ a 373 K subindo para 44 anos a 273 K) 32 Teorias sobre a biogênese

33 Teoria do RNA piranosílico (6 carbonos) : Eschenmoser (1996) e outros sugerem molécula chamada de RNA piranosílico como precursora da vida no planeta 33 RNA piranosílico Teorias sobre a biogênese

34 Teoria do RNA piranosílico (6 carbonos) : Eschenmoser (1996) e outros sugerem molécula chamada de RNA piranosílico como precursora da vida no planeta 34 http://cas.bellarmine.edu/tietjen/Ecology/chemical_etiology_of_nucleic_aci.htm Teorias sobre a biogênese

35 Teoria da origem dos constituintes do espaço (panspermia) ou de fendas marinhas (vulcões) Teoria antiga (Arrhenius 1859-1927) mas, mesmo em tempos relativamente recentes ela ressurge Francis Crick & Leslie Orgel (1985): artigo sobre vinda de formas vivas em veículo espacial para a terra 35 http://tallbloke.files.wordpress.com/2011/02/amersham.jpg Io9.com Teorias sobre a biogênese

36 Teoria da origem dos constituintes do espaço (panspermia) ou de fendas marinhas (vulcões) Vulcões como fonte dos elementos iniciais para síntese de biomoléculas Vulcões como fonte de energia na forma de calor e de descargas elétricas A atividade de vulcões 4 bilhões de anos atrás era muito mais intensa do que hoje Muitos minerais catalíticos ativos estão presentes ao redor e em vulcões 36 Teorias sobre a biogênese ign.com bbc.co.uk

37 Elementos que poderiam incitar a formação de precursores da vida : Energia do interior da terra e de vulcões Energia na forma de UV do sol Radiação de alta energia: isótopos 40 K, 238 U, 235 U and 232 Th (na decomposição geram energia do tipo α-, β- and γ) Descargas elétricas (sua decomposição pode liberar energia para ionização e ativação) Ondas de choque (raios, explosões vulcânicas, impactos de meteoritos, etc.) 37 Teorias sobre a biogênese

38 Teorias de superfície: propõe que os primeiros organismos eram litotróficos termofílicos anaeróbios que obtinham tanto energia quanto o carbono de compostos inorgânicos Pirita (Wächtershäuser, 1988) : Fe-S (teoria quimioautotrófica) 38 http://en.wikipedia.org Rauchfuss, 2008 Teorias sobre a biogênese

39 Teorias de superfície: propõe que os primeiros organismos eram litotróficos termofílicos anaeróbios que obtinham tanto energia quanto o carbono de compostos inorgânicos Pirita : O Fe da pirita apresenta cargas positivas e permite a ligação de fosfatos (PO 4 3- ) possibilitando reações de polimerização A polimerização de lipídios criou membranas semipermeáveis através das quais foi possível gerar e manter um gradiente de prótons, produzindo energia para a síntese das reações sintéticas envolvendo compostos orgânicos gerados tanto dentro quanto fora da membrana 39 Teorias sobre a biogênese

40 Teorias de superfície: propõe que os primeiros organismos eram litotróficos termofílicos anaeróbios que obtinham tanto energia quanto o carbono de compostos orgânicos Partículas de argila : Graham Cairns-Smith (University of Glasgow) propôs, na década de 70, que a origem teria sido inorgânica, na configuração de cátions em partículas de montmorilonita como o repositor da informação genética Seven clues to the origin of life (1995) 40 http://environment.uwe.ac.uk/geocal/SoilMech/classification/soilclas.htm Teorias sobre a biogênese

41 Teoria evolucionista/evolutiva Século XIX duas hipóteses derrubaram a teoria da geração espontânea: Pasteur e o experimento do pescoço de cisne Darwin e Wallace e a teoria da maior adaptabilidade resultando maior sucesso reprodutivo, fazendo com que suas proles herdem e perpetuem essas características (pressão ambiental seleciona características mais apropriadas) Seleção natural faz com que indivíduos simples evolvam a indivíduos mais complexos Variações impostas pela seleção natural e incorporadas são responsáveis pela variabilidade genética e a criação de novos indivíduos 41 Teorias sobre a biogênese

42 Como definir VIDA Pelo menos 100 atributos para definir o que é vivo (Clark, 2002) Algumas características comuns a todas as formas de vida Capacidade de auto replicação (reprodução) Presença de eventos de mutação: variabilidade Capacidade metabolizante Life is a system which is self-sustaining by utilizing external energy/nutrients owing to its internal process of component production and coupled to the medium via adaptive changes which persist during the time history of the system (Luisi, 1998) 42 Teorias sobre a biogênese Clark B (2002) Second Astrobiology Conference, NASA-Ames Research Center http://www.astrobiology.com/asc2002/abstract.htmlhttp://www.astrobiology.com/asc2002/abstract.html Luisi PL (1998) About various definitions of life. Origins Life Evol Biosphere 28:613-622 http://www.astro.iag.usp.br/~amancio/aga0316_artigos/Luisi98.pdf http://www.astro.iag.usp.br/~amancio/aga0316_artigos/Luisi98.pdf

43 Evolução da atmosfera A atmosfera evoluiu a medida que o O 2 tornou-se mais abundante (± 2,5 Ba) O conteúdo de O 2 aumentou gradativamente 0,1 % de O 2 na atmosfera depois de 0,1 Ba (± 2,4 Ba) 1,0 % de O 2 na atmosfera depois de 0,5 Ba (± 2 Ba) 10 % de O 2 na atmosfera depois de 1 Ba (± 1,5 Ba) 21 % de O 2 na atmosfera depois de 1,6 Ba (± 0,9 Ba) Organismos evoluíram (maior diversidade) com a mudança de uma atmosfera reduzida a uma oxidada (O 2 como aceptor final de eletrons) A diversidade microbiana aumentou ± 0,5 Ba depois do início da geração de O 2 Eucarióticos modernos evoluíram ± 1,3 Ba (1,2 Ba após o início da geração de O 2 ) 43

44 Mutações (UV e outros) e a seleção natural fizeram com que microrganismos mais adaptados aparecessem, com parede celular distinta, distintas capacidades biossintéticas, membranas mais complexas, citocromos, clorofilas, fazendo, assim, com que surgissem os fototróficos que obtêm energia do sol e carbono de compostos inorgânicos Fotossintetizantes anoxigênicos: Evoluíram cerca de 0,2 Ba depois dos primeiros organismos Usavam apenas o fotossistema I Fotossintetizantes oxigênicos: Evoluíram cerca de 1,2 Ba depois dos primeiros organismos Usavam tanto o fotossistema I quanto o II 44 http://en.wikipedia.org/wiki/Photosynthesis Evolução da atmosfera

45 O processo evolutivo Processo de mudanças pelos quais organismos vivos passam e estão sujeitos Evidência do processo evolutivo é visto nos fósseis (paleontologia), nos estudos comparativos sobre a estrutura dos organismos (anatomia comparativa), bioquímica, embriologia e biogeografia 45 http://www.goldiesroom.org/Note%20Packets/21%20Evolution/00%20Evolution--WHOLE.htm

46 O processo evolutivo Leslie Orgel (1997): cerca de 2 milhões de espécies vivas Michael Rosenzweig (2003) – Ecologia reconciliatória: 2 a 100 milhões de espécies vivas Mark Neumann (1994): 99.9% de todas as espécies vivas já foram extintas ± 2 bilhões de espécies evoluíram nos últimos 600 milhões de anos Portanto, qual é o período de existência de uma determinada espécie ou a razão/velocidade de extinção? 46 http://blog.claudiocrow.com.br/album/default/10 Michael Rosenzweig

47 O processo evolutivo Leslie Orgel (1997): cerca de 2 milhões de espécies vivas Michael Rosenzweig (2003): 2 a 100 milhões de espécies vivas Mark Neumann (1994): 99.9% de todas as espécies vivas já foram extintas ± 2 bilhões de espécies evoluíram nos últimos 600 milhões de anos Portanto, qual é o período de existência de uma determinada espécie ou a taxa de extinção? Número de espécies= 1.980.000.000 Período = 600 milhões Número espécies extintas/ano = 3,3 espécies Uma espécie típica é extinta ± 10 milhões de anos depois de sua primeira aparição 47 http://blog.claudiocrow.com.br/album/default/10

48 48 Eucarya Bacteria Archaea

49 ArchaeaArchaea Fósseis do período Precambriano (3,8 Ba) têm sido detectados na Groelândia, sendo os mais antigos fósseis conhecidos 49 http://www.fossilmuseum.net/fossilrecord/images/erosion.jpg Evolução e os fósseis

50 ArchaeaArchaea Como definir se o fóssil pertence a uma bactéria ou a uma Archaea? 50 Evolução e os fósseis

51 ArchaeaArchaea Como definir se o fóssil pertence a uma bactéria ou a uma Archaea? Presença de estruturas como isoprenos/isoterpenos (CH 2 =C(CH 3 )CH=CH 2 ) das membranas 51 Evolução e os fósseis

52 Its just astounding to see how constant, how conserved, certain sequences motifs – proteins, genes – have been over enormous expanses of time. You can see sequence patterns that have persisted probably for over three billion years. Thats far longer than mountain ranges last, than continents retain their shape É impressionante verificar o quão constante, conservado, certas sequências – proteínas, genes – tem sido por períodos de tempo muito grandes. Você pode ver que o padrão das sequências tem persistido por, provavelmente, mais de 3 bilhões de anos. Isso é muito mais tempo que o tempo de existência de uma cadeia de montanhas, ou mais tempo que aquele nos quais os continentes mantêm sua forma (Carl Woese, 1997) 52

53 Evolução e os fósseis Bacteria : fósseis do período Precambriano (3,5 Ba) - cianobactérias em estromatótilos (aglomerações de cianobactérias com deposições de carbonatos) 53 http://www.ucmp.berkeley.edu/bacteria/bacteriafr.html 1 Ba espécie atual http://www.crikey-adventure-tours.com/images/Stromatolites_underwater_md.jpg

54 Evolução e os fósseis Bacteria : fósseis do período Precambriano (3,5 Ba) - cianobactérias em estromatótilos (aglomerações de cianobactérias com deposições de carbonatos) 54

55 Evolução e os fósseis Bacteria : fósseis do período Precambriano (3,5 Ba) - cianobactérias em estromatótilos (aglomerações de cianobactérias com deposições de carbonatos) 55

56 Eukarya Fósseis de Eukarya conhecidos do Proterozóico (2,5 Ba – 543 Ma): algas (?) Fósseis de animais somente do período Vendiano (650 – 543 Ma) e Cambriano (542 – 488,3 Ma): trilobitas e braquiopodes Como detectar se são fósseis de eucariotos? 56 http://www.ideofact.com/archives/trilobite.jpg http://en.wikipedia.org/wiki/Brachiopod Evolução e os fósseis

57 Eukarya Presença de esteranos (produtos de esteróis das membranas) – precursor dos esteróis 57 Evolução e os fósseis http://en.wikipedia.org/wiki/Brachiopod

58 1,500 Fungos Archaea e Bacteria Cianobactérias

59 A partir de um ancestral comum foram criados inúmeras formas de vida Variabilidade genética aumentou Necessidade de classificar (sistemática) e dar nome aos indivíduos (taxonomia) Os sistemas de classificação Variação ampla Reclassificações constantes Controvérsias Indefinições ainda persistem 59 Classificação e nomenclatura?? ? ? simpsonstrivia.com.ar

60 Os sistemas de classificação 2 reinos – Aristótoles (384 – 322 AC): animais e plantas 3 reinos (2 proposições) – Linnaeus (1707 – 1778): Regnum Animale Regnum Vegetabile Regnum Lapideum (minerais) – Haeckel (1866) Reino Protista (unicelular) Reino Plantae (multicelular) Reino Animalia (multicelular) 60 vida Classificação e nomenclatura http://en.wikipedia.org

61 Os sistemas de classificação 4 reinos – Copeland (1938) Reino Monera (procariotos, p. ex. bactérias e algas verde-azuladas) Reino Protista (eucariotos unicelulares, p. ex. leveduras) Reino Plantae Reino Animalia A partir de 1960 a criação dos Impérios ou Domínios acima de Reino, proposta por Chatton 61 vida Classificação e nomenclatura

62 Os sistemas de classificação 5 reinos – Whittaker (1969) Veja a adoção do sistema de impérios Reino Monera (unicelulares mais simples) Reino Protista (unicelulares mais simples) Reino Plantae (autotrofos multicelulares) Reino Fungi (saprotrofos multicelulares) Reino Animalia (heterotrofos multicelulares) 62 vida Império Procarioto Império Eucarioto Classificação e nomenclatura http://en.wikipedia.org

63 Os sistemas de classificação 6 reinos – Woese (1990) Impérios transformam-se em domínios Reino Bacteria Reino Archaea Reino Protista Reino Plantae Reino Fungi Reino Animalia 63 vida Domínio Archaea Domínio Eukarya Domínio Bacteria Classificação e nomenclatura http://en.wikipedia.org

64 Os sistemas de classificação 6 reinos – Cavalier-Smith (1998) Nesse sistema adota-se o sistema de Impérios Reino Bacteria – Archaeabacteria como sub-reino Reino Protozoa – ex. Amoebozoa, etc. Reino Chromista – ex. Alveolata, Heterokonta Reino Plantae – ex. algas, plantas terrestres Reino Fungi Reino Animalia 64 vida Império Eucariota Império Procariota Classificação e nomenclatura http://en.wikipedia.org

65 65 Chlorobacteria Hadobacteria Cyanobacteria Gracilicutes Eurybacteria Endobacteria Actinobacteria Archaea Eukarya Neomura LUCA/LUA Last (Common) Universal Ancestor Dominios Archaea e Eukarya originados de Bacteria – Cavalier-Smith Parede com peptideoglicano Parede com outras glicoproteinas Classificação e nomenclatura

66 66 Neomura Inclui todas as espécies multicelulares e todos os extremófilos Os neomuranos tem histonas que ajudam a estabilizar seu DNA Classificação e nomenclatura Eucariotos Archaea

67 67 Neomura A grande maioria tem introns Todos usam metionia (MET) como aminoácido iniciador da síntese protéica (Bacteria usa formilmetionina) Usam vários tipos de RNA polimerase (Bacteria usa somente um tipo) Tem colesterol e proteasomas (proteínas complexas de alto PM) encontradas apenas em poucas bactérias (Actinobacteria – grupo mais evoluído de todos nas bactérias) Mitocôndrias presentes em Eukarya é outra evidência = surgiram por endossimbiose em α-Proteobacteria Classificação e nomenclatura

68 Os sistemas de classificação Sociedade Internacional de Protistologistas (2005) Sistema de domínios Bacteria Archaea Excavata – vários protozoários flagelados Amoebozoa – amebóides e fungos limosos Opisthokonta – animais, fungos, choanoflagelados, etc. Rhizaria – Foraminifera, Radiolaria, protozoários amebóides Chromalveolata – Stramenopilos (Heterokonta), Alveolata, etc. Archaeplastida (ou Primoplantae) – plantas terrestres, algas, etc. 68 vida Domínio Archaea Domínio Eukarya Domínio Bacteria Classificação e nomenclatura

69 Bacteria Bergeys Manual of Systematics Classification (2001-2008) – Springer David Bergey foi professor de Bacteriologia na Universidade da Pensilvânia no inicio do século XX Era membro da Sociedade Americana de Bacteriologia (SAB), hoje a Sociedade Americana de Microbiologia Em 1923 foi publicada a primeira edição do Bergeys Manual of Determinative Bacteriology, hoje na nona edição Além dela outras publicações como: Bergeys Manual of Systematics Classification 69 Classificação e nomenclatura

70 Fungos Interational Code of Botanical Nomenclature 10 a edição do The Dictionary of the Fungi 70 Classificação e nomenclatura

71 Virus Interational Committee on Taxonomy of Viruses Baltimore System 71 Classificação e nomenclatura Exemplos Classe Descricção do genoma e estratégia de replicação Vírus bacterianosVírus de animais IDNA fdLambda, T4Herpesvirus, poxvirus IIDNA fs ɸ Χ174 Vírus de anemia de aves IIIRNA fd ɸ 6 Reovírus IVRNA fs (sentido +)MS2Poliomielite VRNA fs (sentido -)Influenza, raiva VIRNA fs (replicação intermediária DNA) Retrovírus (AIDS, cânceres) VII DNA fd (replicação intermermediária RNA) Hepatite B

72 Distância evolucionária ou distância filogenética Medida da divergência evolutiva entre duas sequências homólogas Mais popularmente = é o número de substituições que ocorreram entre duas sequências de nucleotídeos desde o momento que elas separaram-se de um ancestral comum, expresso tanto em número quanto em percentual Distâncias evolucionárias entre grupos filogenéticos podem ser medidas pela diferença na sequência de ácidos nucléicos (aminoácidos), se as moléculas usadas forem: Distribuídas universalmente no grupo estudado De função idêntica (funcionalidade homóloga) Devidamente alinhadas – homologia e heterogeneidade podem ser devidamente identificadas Com razão de mudança das sequências coerente com as distâncias evolucionárias entre os membros 72 Procedimentos moleculares e filogenia

73 Moléculas usadas Inicialmente proteínas com funções fisiológicas fundamentais, tais como citocromo C RNA ribossomal (rRNA) 5S pelo tamanho reduzido e facilidade de isolar. Desvantagens = a pouca complexidade 73 Procedimentos moleculares e filogenia Internal transcribed spacer (ITS) region primers http://www.biology.duke.edu/fungi/mycolab/primers.htm

74 Moléculas usadas Atualmente ATP sintase: Tem funcionalidade homóloga nas espécies onde é encontrada Alinha-se apropriadamente As razões de mudanças das sequências condiz com os métodos de distância evolucionária Os genes são de fácil isolamento 74 Procedimentos moleculares e filogenia CCCCGCTTTAACCGCGCGTTAAAGGC CCCCGCT- -AACCGCGCGTTAAAGGC CCCCGCTTTAACCGCGCGTTAAAGGC CCCCGCATTAAA - - -GCGTTATTGGC CCCCGCTGTAACCGCGCGTTAACGGC Espécie A Espécie B Espécie C

75 Moléculas usadas A maioria dos estudos atuais usa 16S rRNA (18S rRNA em eucariotos) isolado da subunidade menor do ribossomo. Porque? 75 Procedimentos moleculares e filogenia

76 Moléculas usadas A maioria dos estudos atuais usa 16S rRNA (18S rRNA em eucariotos) isolado da subunidade menor do ribossomo É altamente conservado Tem as características descritas anteriormente Tem um nível de complexidade adequado É relativamente fácil de isolar e de trabalhar Mas qual é o principal problema dessa molécula? 76 Procedimentos moleculares e filogenia

77 Moléculas usadas A maioria dos estudos atuais usa 16S rRNA (18S rRNA em eucariotos) isolado da subunidade menor do ribossomo É altamente conservado Tem as características descritas anteriormente Tem um nível de complexidade adequado É relativamente fácil de isolar e de trabalhar Mas qual é o principal problema dessa molécula? Baixa variação a nível interespecífico 77 Procedimentos moleculares e filogenia

78 Moléculas usadas Outras opções: Fatores de elongação Ef-Tu, Ef-G (proteínas responsáveis pelos fatores de elongação) – procariotos Genes ribossomais, mitocondriais e proteínas estruturais - eucariotos 78 Procedimentos moleculares e filogenia

79 Os três domínios (Woese, 1990) e as árvores filogenéticas da vida Porque as árvores filogenéticas da vida ? 79 Classificação e nomenclatura Eucarya Bacteria Archaea Árvore original www.wikipedia.org Árvore atual ?

80 80 www.wikipedia.org Classificação e nomenclatura LUCA/LUA

81 81

82 82 E os vírus? Classificação e nomenclatura melecofone.com.br

83 Mundo de DNA viral LUCA (Genoma de RNA) LUCA = last universal common ancestor Archaea Eukarya Bacteria Linhagens extintas Transição de RNA a DNA fvA fvE fvB

84 www.tolweb.org 84 Classificação e nomenclatura

85 Classificação hierárquica na biologia com oito ranks principais 85 Classificação e nomenclatura Archaea Crenarchaeota Thermoprotei Sulfobolales Sulfobolaceae Sulfolobus solfataricus Isolado do vulcão Solfatara, perto de Nápoles, Itália

86 Diversidade microbiana Estimativas do número de bactérias 40 milhões de bactérias em 1 g de solo 5 x 10 30 bactérias na terra Massa muito > que a massa de plantas e animais 86 http://en.wikipedia.org/wiki/File:SalmonellaNIAID.jpg http://en.wikipedia.org/wiki/bacteria

87 Diversidade microbiana Estimativas do número de Archaea Número desconhecido de espécies Muitos são extremófilos Organismos de onde se originaram os eucariotos? 87 http://en.wikipedia.org/wiki/Archaea

88 Diversidade microbiana Estimativas do número de fungos 1,5 milhão de espécies (Hawskworth 2001) 5,1 milhão (Blackwell 2011) Um pouco mais de 100.000 espécies descritas Indivíduo pode ter várias toneladas (Armillaria solidipes- Oregon) – 20 km 2 ou ± 1000 ha, sendo estimado que tem cerca de 2.400 anos com uma massa de ± 605 toneladas 88 http://en.wikipedia.org/wiki/Armillaria_solidipes http://en.wikipedia.org/wiki/fungi

89 Diversidade microbiana Estimativas do número de Protozoários ± 200.000 espécies no planeta (Adl et al., 2005) 30 a 40 filos Uni ou multicelulares 89 http://en.wikipedia.org/wiki/File:Protist_collage.jpg

90 Diversidade microbiana Estimativas do número de algas microscópicas ± 6.000 espécies no planeta (Thomas, 2002) 30 a 40 filos Uni ou multicelulares 90 http://en.wikipedia.org/wiki/File:Intertidal_greenalgae.jpg

91 Diversidade microbiana Estimativas do número de animais microscópicos Inclui o zooplâncton e as planarias Número de espécies desconhecido Importância para peixes e outros animais aquáticos 91 http://en.wikipedia.org/wiki/File:Hyperia.jpg http://en.wikipedia.org/wiki/File:Antarctic_krill_(Euphausia_superba).jpg

92 Diversidade microbiana Estimativas do número de vírus 10 31 vírus no planeta (Breitbart & Rohwer, 2005) ± 2600 tem sido descritos em detalhe Grande maioria bacteriófagos 92 http://en.wikipedia.org/wiki/File:HepC_replication.png

93 Morfológico: usa apenas características morfológicas. Indivíduos agrupados em função de similaridades e distinguidos entre si em função de descontinuidade de caracteres Biológico (Dobzhansky 1937, Mayr 1942, 1965): população natural ou população de indivíduos com potencial de cruzar entre si e que estão isolados reprodutivamente de outras populações. Não se aplica a indivíduos com reprodução assexuada, como é o caso de muitos fungos Ecológico: um grupo de organismos adaptados a um determinado recurso, nicho, ou ambiente Filogenético (Hibbett): grupo de indivíduos que tem relação genética determinada via meios filogenéticos Filogenético (cladístico): grupo de indivíduos que tem o mesmo ancestral comum. Mantém sua integridade com respeito a outras linhagens tanto no tempo quanto no espaço Genético: indivíduos ou população com DNA similar. Formas de detecção: hibridização, fingerprinting, etc. Fenético: baseado nos fenótipos 93 Conceitos de espécie

94 De Queiroz - espécies são linhagens de metapopulações (Ernst Mayr and the modern concept of species – PNAS, May 2005) 94 Conceito de espécie em Microbiologia

95 De Queiroz - espécies são linhagens de metapopulações (Ernst Mayr and the modern concept of species – PNAS, May 2005) Metapopulações são grupos de sub-populações conectadas Uma linhagem pode ser entendida como uma metapopulação que se estende ao longo do tempo e que ocupa uma zona adaptativa mínina não ocupada por nenhuma outra linhagem e que evolui independentemente de todas as outras linhagens distantes de sua confluência Diferentemente de outros conceitos, linhagens metapopulacionais não necessitam ser fenotipicamente distinguíveis ou diagnosticáveis, nem monofiléticas, ou isoladas reprodutivamente, ou ecologicamente divergentes para ser consideradas espécies Microrganismos unidos por força coesiva podem ser caracterizados como pertencentes a uma única espécie 95 Conceito de espécie em Microbiologia

96 Cohesion (n. lat. cohaerere "stick or stay together") or cohesive attraction or cohesive force is the action or property of like molecules sticking together, being mutually attractive.propertyattractive This is an intrinsic property of a substance that is caused by the shape and structure of its molecules which makes the distribution of orbiting electrons irregular when molecules get close to one another, creating electrical attraction that can maintain a macroscopic structure such as a water drop –substanceelectronselectrical attractionwater drop wikipedia.org 96 Conceito de espécie em Microbiologia

97 E então, como definir espécie em microbiologia? 97 Conceito de espécie em Microbiologia

Carregar ppt "1 Professores: Admir J. Giachini Andrea de Lima Pimenta Daniel Santos Mansur."

Apresentações semelhantes

Anúncios Google