A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

1 Histórico, evolução e classificação Professor: Admir J. Giachini.

Apresentações semelhantes


Apresentação em tema: "1 Histórico, evolução e classificação Professor: Admir J. Giachini."— Transcrição da apresentação:

1 1 Histórico, evolução e classificação Professor: Admir J. Giachini

2 Surgimento da vida na terra Atmosfera primitiva – redutora ou oxidativa? Redutora: a terra coalescendo devagar, gerando pouco calor, o Fe exposto na superfície capturaria todo o oxigênio molecular. Assim, a atmosfera primitiva seria basicamente constituída de H 2 O, H 2, N, NH 3, CH 4 com pouco CO ou CO 2 (Oparin, 1924 – Oparin e Haldane) Ligeiramente oxidativa: a terra coalescendo rápido, gerando muito calor, a maioria do Fe derreteria e escorreria para o centro da terra, permitindo com que o O 2 combinasse com CO 2. Assim, a atmosfera primitiva seria constituída basicamente de H 2 O, CO e CO 2, com traços de N, sulfitos, NH 3, CH 4 e pouco O 2 2

3 Surgimento da vida na terra Água na terra: s urgiu a ± 4 bilhões de anos, demonstrado pela presença de rochas sedimentares (3,8 bilhões de anos) na Groelândia, que requerem água para se formar Primeiramente expelida por vulcões, expandiu e se resfriou, e então se condensou e caiu na forma de chuva 3

4 Surgimento da vida na terra Água na terra: s urgiu a ± 4 bilhões de anos, demonstrado pela presença de rochas sedimentares (3,8 bilhões de anos) na Groelândia, que requerem água para se formar A elevada temperatura da crosta da terra fez com que a água da chuva evaporasse antes de tocar o solo, resultando em ciclos contínuos de expansão, resfriamento, condensação e chuva, iniciando o ciclo da água 4

5 Surgimento da vida na terra Água na terra: s urgiu a ± 4 bilhões de anos, demonstrado pela presença de rochas sedimentares (3,8 bilhões de anos) na Groelândia, que requerem água para se formar Essa água vagarosamente esfriou a superfície da terra, permitindo com que gotas se formassem, dando origem a pequenas poças, fontes, lagos, rios e oceanos 5

6 Surgimento da vida na terra Água na terra: s urgiu a ± 4 bilhões de anos, demonstrado pela presença de rochas sedimentares (3,8 bilhões de anos) na Groelândia, que requerem água para se formar Considerando que a água era acídica (CO 2, SO 2, etc.), a água dissolveu a porção granítica da superfície basáltica liberando sal para salinização e formação dos oceanos 6

7 Origem da vida na terra A ± 4,5 bilhões de anos a terra era um lugar inospitável 7

8 Origem da vida na terra Cerca de 1 bilhão de anos mais tarde apareceram os primeiros organismos capazes de metabolizar (capacidade de acumular e modificar nutrientes e energia) e de reproduzir-se (capacidade de gerar indivíduos como eles) provavelmente anaeróbios termofílicos (como geravam energia?) Como eles chegaram aqui? 8

9 Teorias sobre a origem da vida na terra A sopa primordial: propõe que os primeiros organismos eram organotróficos termofílicos anaeróbios (como a maioria dos fermentadores) que obtinham tanto energia quanto o carbono de compostos orgânicos Reações químicas formaram ácidos graxos, açúcares, aminoácidos, purinas, pirimidinas, nucleotídeos, e polímeros (± 4,1 Ba) quando a atmosfera foi exposta a descargas elétricas e radiação UV Acumulo de compostos gerou os primeiros nichos de vida na terra Agregação espontânea de lipídios e proteínas (3,9 Ba) propiciou a formação de membranas primitivas e internamente incorporada a combinação certa de componentes químicos orgânicos e inorgânicos 9

10 Miller-Urey (University of Chicago) nos anos 50, recriaram, num balão, como teria sido a formação das reações químicas responsáveis pela criação da vida – água, CH 4, NH 3, H 2, descargas elétricas, produzindo moléculas como formaldeído e cianeto de hidrogênio, precursores da glicina 10 Teorias sobre a origem da vida na terra

11 Miller-Urey (University of Chicago) nos anos 50, recriaram, num balão, como teria sido a formação das reações químicas responsáveis pela criação da vida – água, CH 4, NH 3, H 2, descargas elétricas, produzindo moléculas como formaldeído e cianeto de hidrogênio, precursores da glicina 11 Teorias sobre a origem da vida na terra Miller, Stanley L. (May 1953). "Production of Amino Acids Under Possible Primitive Earth Conditions" (PDF). Science 117(3046): 528– 9. Bibcode 1953Sci M.doi: /science PMID "Production of Amino Acids Under Possible Primitive Earth Conditions"ScienceBibcode1953Sci Mdoi /science PMID Miller, Stanley L.; Harold C. Urey (July 1959). "Organic Compound Synthesis on the Primitive Earth". Science 130(3370): 245– 51. Bibcode 1959Sci M.doi: /science PMID Miller states that he made "A more complete analysis of the products" in the 1953 experiment, listing additional results.ScienceBibcode1959Sci Mdoi /science PMID

12 Miller-Urey (University of Chicago) CO 2 CO + [O] (atomic oxygen) CH 4 + 2[O] CH 2 O + H 2 O CO + NH 3 HCN + H 2 O CH 4 + NH 3 HCN + 3H 2 formaldeido, ammonia e HCN reagem formando: CH 2 O + HCN + NH 3 NH 2 -CH 2 -CN + H 2 O NH 2 -CH 2 -CN + 2H 2 O NH 3 + NH 2 -CH 2 -COOH (glicina) 12 Teorias sobre a origem da vida na terra

13 Mesma condição vista em meteoro (Austrália) e encontrada no espaço sideral - 90 aa diferentes (19 deles encontrados na terra) Meteoritos carbonáceos também têm Adenina e Guanina Onde nascem as estrelas há uma abundância de H 2 O, NH 3, formaldeído e cianeto de H 2, compostos da sopa primordial Essa situação só seria possível numa atmosfera redutora, e não oxidativa como é hoje Hipóteses mais recentes duvidam da atmosfera redutora da terra mas mostram que o H constituía cerca de 40 % dos gases terrestres 13 Teorias sobre a origem da vida na terra

14 Teorias de superfície: propõe que os primeiros organismos eram litotróficos termofílicos anaeróbios que obtinham tanto energia quanto o carbono de compostos inorgânicos Pirita : 14 Teorias sobre a origem da vida na terra Rauchfuss, 2008

15 Teorias de superfície: propõe que os primeiros organismos eram litotróficos termofílicos anaeróbios que obtinham tanto energia quanto o carbono de compostos inorgânicos Pirita : O Fe da pirita apresenta cargas positivas e permite a ligação de fosfatos (PO 4 3- ) possibilitando reações de polimerização A polimerização de lipídios criou membranas semipermeáveis através das quais foi possível gerar e manter um gradiente de prótons, produzindo energia para a síntese das reações sintéticas envolvendo compostos orgânicos gerados tanto dentro quanto fora da membrana 15 Teorias sobre a origem da vida na terra

16 Teorias de superfície: propõe que os primeiros organismos eram litotróficos termofílicos anaeróbios que obtinham tanto energia quanto o carbono de compostos orgânicos Partículas de argila : Graham Cairns-Smith (University of Glasgow) propôs, na década de 70, que a origem teria sido inorgânica, na configuração de cátions em partículas de montmorilonita como o repositor da informação genética Seven clues to the origin of life (1995) 16 Teorias sobre a origem da vida na terra

17 Teoria criacionista Antes do século XVII a maioria das pessoas acreditava que Deus criou o homem e que outras criaturas menores fossem criadas via geração espontânea a partir da MO em decomposição 17 Teorias sobre a origem da vida na terra

18 Teoria evolucionista/evolutiva Século XIX duas hipóteses derrubaram teoria da geração espontânea: Pasteur e o experimento do pescoço de cisne Darwin e Wallace e a teoria da maior adaptabilidade resultando maior sucesso reprodutivo, fazendo com que suas proles herdem e perpetuem essas características (pressão ambiental seleciona características mais apropriadas) Seleção natural faz com que indivíduos simples evolvam a indivíduos mais complexos Variações impostas pela seleção natural e incorporadas são responsáveis pela variabilidade genética e a criação de novos indivíduos 18 Teorias sobre a origem da vida na terra

19 Teoria do mundo de RNA Walter Gilbert, da Harvard University, em 1986, sugeriu que tudo se originou a partir de um precursor de RNA – o mundo do RNA, onde essa molécula catalisou todas as reações necessárias para que o último ancestral comum sobrevivesse e se replicasse Teorias sobre a origem da vida na terra Gilbert, W. (1986). "Origin of life: The RNA world". Nature 319 (6055): 618.

20 Teoria do mundo de RNA Na verdade essa hipótese foi primeiro sugerida por Carl Woese (Univeristy of Illinois) na década de 60, e mais tarde também adotada por Francis Crick (Medical Research Council in England) e Leslie Orgel (Salk Institute in San Diego) 20 Teorias sobre a origem da vida na terra Carl Woese thonyPooleInterview.php Francis Crick 11.blogspot.com/2008_10_01_archive.html Leslie Orgel

21 Teoria do mundo de RNA No entanto, quem tenta explicar essa teoria encontra um paradoxo Qual é esse paradoxo? 21 Teorias sobre a origem da vida na terra

22 Teoria do mundo de RNA No entanto, quem tenta explicar essa teoria encontra um paradoxo Ácidos nucléicos somente são sintetizados com o auxilio de proteínas Proteínas somente são sintetizadas se a sequência de nucleotídeos correspondente estiver presente É muito improvável que ambas originaram-se espontaneamente no mesmo lugar e ao mesmo tempo. É muito improvável que um tenha sido gerado sem a presença do outro Isso gera indícios que, aparentemente, a vida não poderia ter sido gerada através de reações químicas 22 Teorias sobre a origem da vida na terra

23 Teoria do mundo de RNA Esse RNA teria, subsequentemente, a habilidade de ligar aminoácidos para formar proteínas Esse cenário só é possível se o RNA prebiótico tivesse 2 condições que não são evidentes hoje: A capacidade de se replicar sem o auxílio de proteínas Habilidade de catalisar cada passo da síntese de proteínas A descoberta de ribozimas, enzimas de RNA, em trabalhos independentes em duas universidades dos EUA nos anos 80 deu credibilidade para essa teoria Essas ribozimas conseguem ligar nucleotídeos, como se faz na síntese de RNA ou DNA Leva a indícios de que, dessa forma, existiu um ancestral comum as formas de vida, dando suporte a teorização do mundo de RNA 23 Teorias sobre a origem da vida na terra

24 Teoria do mundo de RNA Como explicar a questão de existir um ancestral comum? 24 Teorias sobre a origem da vida na terra

25 Teoria do mundo de RNA Como explicar a questão de existir um ancestral comum? Coisas vivas consistem de compostos orgânicos similares (ricos em C) Roll de proteínas sintetizadas a partir de 20 aminoácidos Essas proteínas incluem enzimas essências ao desenvolvimento, sobrevivência e reprodução Organismos contemporâneos carregam sua informação genética em ácidos nucleicos (DNA e RNA) e usam o mesmo código genético Esse código genético define o roll de aminoácidos, proteínas e o funcionamento do organismo Dessa forma a questão muda para: que série de reações químicas criou esse sistema interdependente de ácidos nucleicos e proteínas? 25 Teorias sobre a origem da vida na terra

26 Teoria da origem dos constituintes do espaço (panspermia) ou de fendas marinhas Ainda fica a questão de como o RNA foi constituído: sem enzimas é muito difícil sintetizar ribose Ribose pode ser formada tendo formaldeído como precursor, mas em quantidade ínfimas, sendo inibida por outros açúcares que são produzidos em maior quantidade 26 Teorias sobre a origem da vida na terra Io9.com

27 Teoria do RNA piranosílico (6 carbonos) : Eschenmoser (1996) e outros sugerem molécula chamada de RNA piranosílico como precursora da vida no planeta 27 Teorias sobre a origem da vida na terra RNA piranosílico

28 Teoria do RNA piranosílico (6 carbonos) : Eschenmoser (1996) e outros sugerem molécula chamada de RNA piranosílico como precursora da vida no planeta 28 Teorias sobre a origem da vida na terra

29 Evolução da atmosfera A atmosfera evoluiu a medida que o O 2 tornou-se mais abundante (± 2,5 Ba) O conteúdo de O 2 aumentou gradativamente 0,1 % de O 2 na atmosfera depois de 0,1 Ba (± 2,4 Ba) 1,0 % de O 2 na atmosfera depois de 0,5 Ba (± 2 Ba) 10 % de O 2 na atmosfera depois de 1 Ba (± 1,5 Ba) 21 % de O 2 na atmosfera depois de 1,6 Ba (± 0,9 Ba) Organismos evoluíram (maior diversidade) com a mudança de uma atmosfera reduzida a uma oxidada (O 2 como aceptor final de eletrons) A diversidade microbiana aumentou ± 0,5 Ba depois do início da geração de O 2 Eucarióticos modernos evoluíram ± 1,3 Ba (1,2 Ba após o início da geração de O 2 ) 29

30 Mutações (UV e outros) e a seleção natural fizeram com que microrganismos mais adaptados aparecessem, com parede celular distinta, distintas capacidades biossintéticas, membranas mais complexas, citocromos, clorofilas, fazendo, assim, com que surgissem os fototróficos que obtêm energia do sol e carbono de compostos inorgânicos Fotossintetizantes anoxigênicos: Evoluíram cerca de 0,2 Ba depois dos primeiros organismos Usavam apenas o fotossistema I Fotossintetizantes oxigênicos: Evoluíram cerca de 1,2 Ba depois dos primeiros organismos Usavam tanto o fotossistema I quanto o II 30 Evolução da atmosfera

31 O processo evolutivo Processo de mudanças pelos quais organismos vivos passam e estão sujeitos Evidência do processo evolutivo é visto nos fósseis (paleontologia), nos estudos comparativos sobre a estrutura dos organismos (anatomia comparativa), bioquímica, embriologia e biogeografia 31

32 O processo evolutivo Leslie Orgel (1997): cerca de 2 milhões de espécies vivas Michael Rosenzweig (2003) – Ecologia reconciliatória: 2 a 100 milhões de espécies vivas Mark Neumann (1994): 99.9% de todas as espécies vivas já foram extintas ± 2 bilhões de espécies evoluíram nos últimos 600 milhões de anos Portanto, qual é o período de existência de uma determinada espécie ou a razão/velocidade de extinção? 32 Michael Rosenzweig

33 O processo evolutivo Leslie Orgel (1997): cerca de 2 milhões de espécies vivas Michael Rosenzweig (2003): 2 a 100 milhões de espécies vivas Mark Neumann (1994): 99.9% de todas as espécies vivas já foram extintas ± 2 bilhões de espécies evoluíram nos últimos 600 milhões de anos Portanto, qual é o período de existência de uma determinada espécie ou a taxa de extinção? Número de espécies= Período = 600 milhões Número espécies extintas/ano = 3,3 espécies Uma espécie típica é extinta ± 10 milhões de anos depois de sua primeira aparição 33

34 34 Eucarya Bacteria Archaea

35 ArchaeaArchaea Fósseis do período Precambriano (3,8 Ba) têm sido detectados na Groelândia, sendo os mais antigos fósseis conhecidos 35 Evolução e os fósseis

36 ArchaeaArchaea Como definir se o fóssil pertence a uma bactéria ou a uma Archaea? 36 Evolução e os fósseis

37 ArchaeaArchaea Como definir se o fóssil pertence a uma bactéria ou a uma Archaea? Presença de estruturas como isoprenos/isoterpenos (CH 2 =C(CH 3 )CH=CH 2 ) das membranas 37 Evolução e os fósseis

38 Its just astounding to see how constant, how conserved, certain sequences motifs – proteins, genes – have been over enormous expanses of time. You can see sequence patterns that have persisted probably for over three billion years. Thats far longer than mountain ranges last, than continents retain their shape É impressionante verificar o quão constante, conservado, certas sequências – proteínas, genes – tem sido por períodos de tempo muito grandes. Você pode ver que o padrão das sequências tem persistido por, provavelmente, mais de 3 bilhões de anos. Isso é muito mais tempo que o tempo de existência de uma cadeia de montanhas, ou mais tempo que aquele nos quais os continentes mantêm sua forma (Carl Woese, 1997) 38

39 Evolução e os fósseis Bacteria : fósseis do período Precambriano (3,5 Ba) - cianobactérias em estromatótilos (aglomerações de cianobactérias com deposições de carbonatos) Ba espécie atual

40 Evolução e os fósseis Bacteria : fósseis do período Precambriano (3,5 Ba) - cianobactérias em estromatótilos (aglomerações de cianobactérias com deposições de carbonatos) 40

41 Evolução e os fósseis Bacteria : fósseis do período Precambriano (3,5 Ba) - cianobactérias em estromatótilos (aglomerações de cianobactérias com deposições de carbonatos) 41

42 Eukarya Fósseis de Eukarya conhecidos do Proterozóico (2,5 Ba – 543 Ma): algas (?) Fósseis de animais somente do período Vendiano (650 – 543 Ma) e Cambriano (542 – 488,3 Ma): trilobitas e braquiopodes Como detectar se são fósseis de eucariotos? 42 Evolução e os fósseis

43 Eukarya Presença de esteranos (produtos de esteróis das membranas) – precursor dos esteróis 43 Evolução e os fósseis

44 1,500 Fungos Archaea e Bacteria Cianobactérias

45 A partir de um ancestral comum foram criados inúmeras formas de vida Variabilidade genética aumentou Necessidade de classificar (sistemática) e dar nome aos indivíduos (taxonomia) Os sistemas de classificação Variação ampla Reclassificações constantes Controvérsias Indefinições ainda persistem 45 Classificação e nomenclatura?? ? ? simpsonstrivia.com.ar

46 Os sistemas de classificação 2 reinos – Aristótoles (384 – 322 AC): animais e plantas 3 reinos (2 proposições) – Linnaeus (1707 – 1778): Regnum Animale Regnum Vegetabile Regnum Lapideum (minerais) – Haeckel (1866) Reino Protista (unicelular) Reino Plantae (multicelular) Reino Animalia (multicelular) 46 vida Classificação e nomenclatura

47 Os sistemas de classificação 4 reinos – Copeland (1938) Reino Monera (procariotos, p. ex. bactérias e algas verde-azuladas) Reino Protista (eucariotos unicelulares, p. ex. leveduras) Reino Plantae Reino Animalia A partir de 1960 a criação dos Impérios ou Domínios acima de Reino, proposta por Chatton 47 vida Classificação e nomenclatura

48 Os sistemas de classificação 5 reinos – Whittaker (1969) Veja a adoção do sistema de impérios Reino Monera (unicelulares mais simples) Reino Protista (unicelulares mais simples) Reino Plantae (autotrofos multicelulares) Reino Fungi (saprotrofos multicelulares) Reino Animalia (heterotrofos multicelulares) 48 vida Império Procarioto Império Eucarioto Classificação e nomenclatura

49 Os sistemas de classificação 6 reinos – Woese (1990) Impérios transformam-se em domínios Reino Bacteria Reino Archaea Reino Protista Reino Plantae Reino Fungi Reino Animalia 49 vida Domínio Archaea Domínio Eukarya Domínio Bacteria Classificação e nomenclatura

50 Os sistemas de classificação 6 reinos – Cavalier-Smith (1998) Nesse sistema adota-se o sistema de Impérios Reino Bacteria – Archaeabacteria como sub-reino Reino Protozoa – ex. Amoebozoa, etc. Reino Chromista – ex. Alveolata, Heterokonta Reino Plantae – ex. algas, plantas terrestres Reino Fungi Reino Animalia 50 vida Império Eucariota Império Procariota Classificação e nomenclatura

51 51 Chlorobacteria Hadobacteria Cyanobacteria Gracilicutes Eurybacteria Endobacteria Actinobacteria Archaea Eukarya Neomura LUCA/LUA Last (Common) Universal Ancestor Dominios Archaea e Eukarya originados de Bacteria – Cavalier-Smith Parede com peptideoglicano Parede com outras glicoproteinas Classificação e nomenclatura

52 52 Neomura Inclui todas as espécies multicelulares e todos os extremófilos Os neomuranos tem histonas que ajudam a estabilizar seu DNA Classificação e nomenclatura Eucariotos Archaea

53 53 Neomura A grande maioria tem introns Todos usam metionia (MET) como aminoácido iniciador da síntese protéica (Bacteria usa formilmetionina) Usam vários tipos de RNA polimerase (Bacteria usa somente um tipo) Tem colesterol e proteasomas (proteínas complexas de alto PM) encontradas apenas em poucas bactérias (Actinobacteria – grupo mais evoluído de todos nas bactérias) Mitocôndrias presentes em Eukarya é outra evidência = surgiram por endossimbiose em α-Proteobacteria Classificação e nomenclatura

54 Os sistemas de classificação Sociedade Internacional de Protistologistas (2005) Sistema de domínios Bacteria Archaea Excavata – vários protozoários flagelados Amoebozoa – amebóides e fungos limosos Opisthokonta – animais, fungos, choanoflagelados, etc. Rhizaria – Foraminifera, Radiolaria, protozoários amebóides Chromalveolata – Stramenopilos (Heterokonta), Alveolata, etc. Archaeplastida (ou Primoplantae) – plantas terrestres, algas, etc. 54 vida Domínio Archaea Domínio Eukarya Domínio Bacteria Classificação e nomenclatura

55 Bacteria Bergeys Manual of Systematics Classification ( ) – Springer David Bergey foi professor de Bacteriologia na Universidade da Pensilvânia no inicio do século XX Era membro da Sociedade Americana de Bacteriologia (SAB), hoje a Sociedade Americana de Microbiologia Em 1923 foi publicada a primeira edição do Bergeys Manual of Determinative Bacteriology, hoje na nona edição Além dela outras publicações como: Bergeys Manual of Systematics Classification 55 Classificação e nomenclatura

56 Fungos Interational Code of Botanical Nomenclature 10 a edição do The Dictionary of the Fungi 56 Classificação e nomenclatura

57 Virus Interational Committee on Taxonomy of Viruses Baltimore System 57 Classificação e nomenclatura Exemplos Classe Descricção do genoma e estratégia de replicação Vírus bacterianosVírus de animais IDNA fdLambda, T4Herpesvirus, poxvirus IIDNA fs ɸ Χ174 Vírus de anemia de aves IIIRNA fd ɸ 6 Reovírus IVRNA fs (sentido +)MS2Poliomielite VRNA fs (sentido -)Influenza, raiva VIRNA fs (replicação intermediária DNA) Retrovírus (AIDS, cânceres) VII DNA fd (replicação intermermediária RNA) Hepatite B

58 Distância evolucionária ou distância filogenética Medida da divergência evolutiva entre duas sequências homólogas Mais popularmente = é o número de substituições que ocorreram entre duas sequências de nucleotídeos desde o momento que elas separaram-se de um ancestral comum, expresso tanto em número quanto em percentual Distâncias evolucionárias entre grupos filogenéticos podem ser medidas pela diferença na sequência de ácidos nucléicos (aminoácidos), se as moléculas usadas forem: Distribuídas universalmente no grupo estudado De função idêntica (funcionalidade homóloga) Devidamente alinhadas – homologia e heterogeneidade podem ser devidamente identificadas Com razão de mudança das sequências coerente com as distâncias evolucionárias entre os membros 58 Procedimentos moleculares e filogenia

59 Moléculas usadas Inicialmente proteínas com funções fisiológicas fundamentais, tais como citocromo C RNA ribossomal (rRNA) 5S pelo tamanho reduzido e facilidade de isolar. Desvantagens = a pouca complexidade 59 Procedimentos moleculares e filogenia Internal transcribed spacer (ITS) region primers

60 Moléculas usadas Atualmente ATP sintase: Tem funcionalidade homóloga nas espécies onde é encontrada Alinha-se apropriadamente As razões de mudanças das sequências condiz com os métodos de distância evolucionária Os genes são de fácil isolamento 60 Procedimentos moleculares e filogenia CCCCGCTTTAACCGCGCGTTAAAGGC CCCCGCT- -AACCGCGCGTTAAAGGC CCCCGCTTTAACCGCGCGTTAAAGGC CCCCGCATTAAA - - -GCGTTATTGGC CCCCGCTGTAACCGCGCGTTAACGGC Espécie A Espécie B Espécie C

61 Moléculas usadas A maioria dos estudos atuais usa 16S rRNA (18S rRNA em eucariotos) isolado da subunidade menor do ribossomo. Porque? 61 Procedimentos moleculares e filogenia

62 Moléculas usadas A maioria dos estudos atuais usa 16S rRNA (18S rRNA em eucariotos) isolado da subunidade menor do ribossomo É altamente conservado Tem as características descritas anteriormente Tem um nível de complexidade adequado É relativamente fácil de isolar e de trabalhar Mas qual é o principal problema dessa molécula? 62 Procedimentos moleculares e filogenia

63 Moléculas usadas A maioria dos estudos atuais usa 16S rRNA (18S rRNA em eucariotos) isolado da subunidade menor do ribossomo É altamente conservado Tem as características descritas anteriormente Tem um nível de complexidade adequado É relativamente fácil de isolar e de trabalhar Mas qual é o principal problema dessa molécula? Baixa variação a nível interespecífico 63 Procedimentos moleculares e filogenia

64 Moléculas usadas Outras opções: Fatores de elongação Ef-Tu, Ef-G (proteínas responsáveis pelos fatores de elongação) – procariotos Genes ribossomais, mitocondriais e proteínas estruturais - eucariotos 64 Procedimentos moleculares e filogenia

65 Os três domínios (Woese, 1990) e as árvores filogenéticas da vida Porque as árvores filogenéticas da vida ? 65 Classificação e nomenclatura Eucarya Bacteria Archaea Árvore original Árvore atual ?

66 66 Classificação e nomenclatura LUCA/LUA

67 67

68 68 E os vírus? Classificação e nomenclatura melecofone.com.br

69 Mundo de DNA viral LUCA (Genoma de RNA) LUCA = last universal common ancestor Archaea Eukarya Bacteria Linhagens extintas Transição de RNA a DNA fvA fvE fvB

70 70 Classificação e nomenclatura

71 Classificação hierárquica na biologia com oito ranks principais 71 Classificação e nomenclatura Archaea Crenarchaeota Thermoprotei Sulfobolales Sulfobolaceae Sulfolobus solfataricus Isolado do vulcão Solfatara, perto de Nápoles, Itália

72 Diversidade microbiana Estimativas do número de bactérias 40 milhões de bactérias em 1 g de solo 5 x bactérias na terra Massa muito > que a massa de plantas e animais 72

73 Diversidade microbiana Estimativas do número de Archaea Número desconhecido de espécies Muitos são extremófilos Organismos de onde se originaram os eucariotos? 73

74 Diversidade microbiana Estimativas do número de fungos 1,5 milhão de espécies (Hawskworth 2001) 5,1 milhão (Blackwell 2011) Um pouco mais de espécies descritas Indivíduo pode ter várias toneladas (Armillaria solidipes- Oregon) – 20 km 2 ou ± 1000 ha, sendo estimado que tem cerca de anos com uma massa de ± 605 toneladas 74

75 Diversidade microbiana Estimativas do número de Protozoários ± espécies no planeta (Adl et al., 2005) 30 a 40 filos Uni ou multicelulares 75

76 Diversidade microbiana Estimativas do número de algas microscópicas ± espécies no planeta (Thomas, 2002) 30 a 40 filos Uni ou multicelulares 76

77 Diversidade microbiana Estimativas do número de animais microscópicos Inclui o zooplâncton e as planarias Número de espécies desconhecido Importância para peixes e outros animais aquáticos 77

78 Diversidade microbiana Estimativas do número de vírus vírus no planeta (Breitbart & Rohwer, 2005) ± 5000 tem sido descritos em detalhe Grande maioria bacteriófagos 78

79 Morfológico: usa apenas características morfológicas. Indivíduos agrupados em função de similaridades e distinguidos entre si em função de descontinuidade de caracteres Biológico (Dobzhansky 1937, Mayr 1942, 1965): população natural ou população de indivíduos com potencial de cruzar entre si e que estão isolados reprodutivamente de outras populações. Não se aplica a indivíduos com reprodução assexuada, como é o caso de muitos fungos Ecológico: um grupo de organismos adaptados a um determinado recurso, nicho, ou ambiente Filogenético (Hibbett): grupo de indivíduos que tem relação genética determinada via meios filogenéticos Filogenético (cladístico): grupo de indivíduos que tem o mesmo ancestral comum. Mantém sua integridade com respeito a outras linhagens tanto no tempo quanto no espaço Genético: indivíduos ou população com DNA similar. Formas de detecção: hibridização, fingerprinting, etc. Fenético: baseado nos fenótipos 79 Conceitos de espécie

80 De Queiroz - espécies são linhagens de metapopulações (Ernst Mayr and the modern concept of species – PNAS, May 2005) 80 Conceito de espécie em Microbiologia

81 De Queiroz - espécies são linhagens de metapopulações (Ernst Mayr and the modern concept of species – PNAS, May 2005) Metapopulações são grupos de sub-populações conectadas Uma linhagem pode ser entendida como uma metapopulação que se estende ao longo do tempo e que ocupa uma zona adaptativa mínina não ocupada por nenhuma outra linhagem e que evolui independentemente de todas as outras linhagens distantes de sua confluência Diferentemente de outros conceitos, linhagens metapopulacionais não necessitam ser fenotipicamente distinguíveis ou diagnosticáveis, nem monofiléticas, ou isoladas reprodutivamente, ou ecologicamente divergentes para ser consideradas espécies Microrganismos unidos por força coesiva podem ser caracterizados como pertencentes a uma única espécie 81 Conceito de espécie em Microbiologia

82 Cohesion (n. lat. cohaerere "stick or stay together") or cohesive attraction or cohesive force is the action or property of like molecules sticking together, being mutually attractive.propertyattractive This is an intrinsic property of a substance that is caused by the shape and structure of its molecules which makes the distribution of orbiting electrons irregular when molecules get close to one another, creating electrical attraction that can maintain a macroscopic structure such as a water drop –substanceelectronselectrical attractionwater drop wikipedia.org 82 Conceito de espécie em Microbiologia

83 E então, como definir espécie em microbiologia? 83 Conceito de espécie em Microbiologia


Carregar ppt "1 Histórico, evolução e classificação Professor: Admir J. Giachini."

Apresentações semelhantes


Anúncios Google