A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

CONVERSOR DE DNA Aperte Enter para começar!. 1 – Digitar a sequência gênica 2 – Obter sequência de um arquivo (.TXT) Aperte Esc para sair!

Apresentações semelhantes


Apresentação em tema: "CONVERSOR DE DNA Aperte Enter para começar!. 1 – Digitar a sequência gênica 2 – Obter sequência de um arquivo (.TXT) Aperte Esc para sair!"— Transcrição da apresentação:

1 CONVERSOR DE DNA Aperte Enter para começar!

2 1 – Digitar a sequência gênica 2 – Obter sequência de um arquivo (.TXT) Aperte Esc para sair!

3 Escolha entre as opções 1 e 2! Voltar ao Menu principal Aperte Esc para sair!

4 Voltar ao Menu principal Digite a sequência com a inicial das bases nitrogenadas: Atenção: a sequência deve conter as bases nitrogenadas: A (Adenina) T (Timina) C (Citosina) G (Guanina) GGCTAGCTAGCGTAGCGATGCAAATTTAAATATATGATC

5 Arquivo de texto Voltar ao Menu principal Lendo arquivo...

6 Voltar ao Menu principal 3. Mostrar RNA - Transportadores 2. Formar a fita complementar 1. Formar RNA – Mensageiro (RNAm) 4. Mostrar a proteína formada (conjunto de aminoácidos) 5. Tabela de códons do RNAm e aminoácidos 6. Registrar resultados em arquivo (.TXT) Aperte Esc para sair!

7 RNA-Mensageiro CCG AUC GAU CGC AUC GCU ACG UUU AAA UUU AUA UAC UAG Voltar ao Menu anterior

8 Fita complementar do DNA CCG ATC GAT CGC ATC GCT ACG TTT AAA TTT ATA TAC TAG Voltar ao Menu anterior

9 RNA-Transportadores GGC UAG CUA GCG UAG CGA UGC AAA UUU AAA UAU AUG AUC Voltar ao Menu anterior

10 Proteína formada Prolina - Isoleucina - Ácido Aspártico - Arginina - Isoleucina - Alanina - Treonina - Fenilalanina - Lisina - Fenilalanina - Isoleucina - Tirosina - STOP Voltar ao Menu anterior

11 Tabela de códons do RNAm e aminoácidos Voltar ao Menu anterior Primeira Base Segunda Base Terceira Base UCAG Uracila ( U ) fenilalaninaserinatisosinacisteína U fenilalaninaserinatisosina cisteínaC leucinaserinaSTOP A leucinaserinaSTOP triptófanoG Citosina ( C ) leucinaserinahistidina argininaU leucinaprolinahistidina argininaC leucinaprolinaglutamina argininaA leucinaprolinaglutamina argininaG Adenina ( A ) isoleucinaprolinaasparagina serinaU isoleucinatreoninaasparagina serinaC isoleucinatreoninalisina argininaA metioninatreoninalisina argininaG Guanina ( G ) valinaalaninaácido aspártico glicinaU valinaalaninaácido aspártico glicinaC valinaalaninaácido glutâmico glicinaA valinaalaninaácido glutâmico glicinaG

12 Arquivo dos resultados Voltar ao Menu anterior

13 Nome do Grupo Sergio Zumpano Arnosti - 7573336 Danillo Badolato Athayde - 7656432 BCC-2011 – Turma B1. USP – São Carlos.


Carregar ppt "CONVERSOR DE DNA Aperte Enter para começar!. 1 – Digitar a sequência gênica 2 – Obter sequência de um arquivo (.TXT) Aperte Esc para sair!"

Apresentações semelhantes


Anúncios Google