A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

CONVERSOR DE DNA Aperte Enter para começar!. 1 – Digitar a sequência gênica 2 – Obter sequência de um arquivo (.TXT) Aperte Esc para sair!

Apresentações semelhantes


Apresentação em tema: "CONVERSOR DE DNA Aperte Enter para começar!. 1 – Digitar a sequência gênica 2 – Obter sequência de um arquivo (.TXT) Aperte Esc para sair!"— Transcrição da apresentação:

1 CONVERSOR DE DNA Aperte Enter para começar!

2 1 – Digitar a sequência gênica 2 – Obter sequência de um arquivo (.TXT) Aperte Esc para sair!

3 Escolha entre as opções 1 e 2! Voltar ao Menu principal Aperte Esc para sair!

4 Voltar ao Menu principal Digite a sequência com a inicial das bases nitrogenadas: Atenção: a sequência deve conter as bases nitrogenadas: A (Adenina) T (Timina) C (Citosina) G (Guanina) GGCTAGCTAGCGTAGCGATGCAAATTTAAATATATGATC

5 Arquivo de texto Voltar ao Menu principal Lendo arquivo...

6 Voltar ao Menu principal 3. Mostrar RNA - Transportadores 2. Formar a fita complementar 1. Formar RNA – Mensageiro (RNAm) 4. Mostrar a proteína formada (conjunto de aminoácidos) 5. Tabela de códons do RNAm e aminoácidos 6. Registrar resultados em arquivo (.TXT) Aperte Esc para sair!

7 RNA-Mensageiro CCG AUC GAU CGC AUC GCU ACG UUU AAA UUU AUA UAC UAG Voltar ao Menu anterior

8 Fita complementar do DNA CCG ATC GAT CGC ATC GCT ACG TTT AAA TTT ATA TAC TAG Voltar ao Menu anterior

9 RNA-Transportadores GGC UAG CUA GCG UAG CGA UGC AAA UUU AAA UAU AUG AUC Voltar ao Menu anterior

10 Proteína formada Prolina - Isoleucina - Ácido Aspártico - Arginina - Isoleucina - Alanina - Treonina - Fenilalanina - Lisina - Fenilalanina - Isoleucina - Tirosina - STOP Voltar ao Menu anterior

11 Tabela de códons do RNAm e aminoácidos Voltar ao Menu anterior Primeira Base Segunda Base Terceira Base UCAG Uracila ( U ) fenilalaninaserinatisosinacisteína U fenilalaninaserinatisosina cisteínaC leucinaserinaSTOP A leucinaserinaSTOP triptófanoG Citosina ( C ) leucinaserinahistidina argininaU leucinaprolinahistidina argininaC leucinaprolinaglutamina argininaA leucinaprolinaglutamina argininaG Adenina ( A ) isoleucinaprolinaasparagina serinaU isoleucinatreoninaasparagina serinaC isoleucinatreoninalisina argininaA metioninatreoninalisina argininaG Guanina ( G ) valinaalaninaácido aspártico glicinaU valinaalaninaácido aspártico glicinaC valinaalaninaácido glutâmico glicinaA valinaalaninaácido glutâmico glicinaG

12 Arquivo dos resultados Voltar ao Menu anterior

13 Nome do Grupo Sergio Zumpano Arnosti Danillo Badolato Athayde BCC-2011 – Turma B1. USP – São Carlos.


Carregar ppt "CONVERSOR DE DNA Aperte Enter para começar!. 1 – Digitar a sequência gênica 2 – Obter sequência de um arquivo (.TXT) Aperte Esc para sair!"

Apresentações semelhantes


Anúncios Google