A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Licenciatura em Ciências Biomédicas Laboratórios Biomoleculares I Módulo II 2011/2012.

Apresentações semelhantes


Apresentação em tema: "Licenciatura em Ciências Biomédicas Laboratórios Biomoleculares I Módulo II 2011/2012."— Transcrição da apresentação:

1 Licenciatura em Ciências Biomédicas Laboratórios Biomoleculares I Módulo II 2011/2012

2 Sumário Motivação e Apresentação do Módulo – Objectivos – Metodologia de Avaliação – Calendarização Módulo II - Tipagem Molecular O que é? Aplicações da Tipagem Molecular. Os primers a utilizar: identificação e estudo Laboratórios Biomoleculares I MJC - T

3 Objectivos gerais da UC...que os alunos consolidem as competências adquiridas nas unidades curriculares de Biologia Molecular, Genética Molecular e Humana, Bioquímica Estrutural e Tópicos em Biomedicina Laboratórios Biomoleculares I MJC - T

4 Objectivos específicos - Módulo II É esperado que os alunos consigam desenhar e compreender o procedimento experimental utilizado para fazer tipagem de organismos e interpretar resultados experimentais de tipagem Laboratórios Biomoleculares I MJC - T

5 Avaliação Laboratórios Biomoleculares I MJC - T Avaliação por Frequências A nota mínima 9,5 valores. Inclui 2 grupos relativos aos conteúdos leccionados por cada um dos docentes. Uma frequência cujo peso na classificação final é de 30% Nota mínima de 10,0 valores. Será calculada como a média ponderada das classificações de cada módulo. O Módulo I tem um peso de 2/3 na classificação final e o Módulo II 1/3. Vale 70% da classificação final por frequência. Módulo I – Nuno Rosa Os alunos serão avaliados pela sua prestação nas aulas laboratoriais por um questionário a realizar na última aula deste bloco com o peso de 40% na classificação deste bloco. O restante da classificação do bloco é calculado como a média aritmética de uma resposta por escrito a uma questão posta nos últimos 10 minutos das aulas práticas (7 questões no total) com o peso de 30% na classificação deste bloco e de um trabalho escrito em que resumem o trabalho realizado ao longo do semestre, com o peso de 30% na classificação deste bloco. Módulo II - Maria José Correia: Os alunos serão avaliados pela sua prestação nas aulas laboratoriais por um questionário a realizar no fim das aulas com um peso de 1/4 na classificação final do módulo. Os alunos devem também apresentar e discutir na última aula o trabalho desenvolvido durante o módulo. Estas apresentações são individuais e têm um peso de ¼ na classificação final do módulo. O restante ½ da classificação do módulo é obtido com a realização de uma ficha de avaliação com sobre a totalidade do módulo depois da última aula laboratorial.

6 Avaliação Laboratórios Biomoleculares I MJC - T Avaliação por Exame Final do Semestre A nota mínima 9,5 valores. Um teste escrito que inclui 2 grupos relativos aos conteúdos leccionados por cada um dos docentes e cujo peso na classificação final é de 30% Transposta do 1º momento de avaliação. Vale 70% da classificação. Avaliação por Exame de Recurso Prova de exame versando todos os conteúdos leccionados. Este exame inclui uma componente laboratorial co o peso de 50% na classificação final.

7 Programa Disponível no molar Contém calendarização das aulas Laboratórios Biomoleculares I MJC - T

8 Módulo II – Tipagem Molecular Aulas Teórica 1-2

9 Tipagem Molecular O que é? Laboratórios Biomoleculares I MJC - T Para que serve? É o estudo da sequência de DNA para ser possível comparar vários indivíduos. É usado na: Identificação; Classificação; Diagnóstico; Taxonomia.

10 Tipagem Molecular Que técnicas utiliza? Laboratórios Biomoleculares I MJC - T PCR Ciclos de replicação? Primers? Electroforese Condições

11 Várias formas de tipagem Laboratórios Biomoleculares I MJC - T

12 Escolha do método de tipagem de acordo com a finalidade pretendida – Identificação vs. Diferenciação – reprodutibilidade – poder discriminatório – custos Laboratórios Biomoleculares I MJC - T

13 Alguns métodos de genotipagem RFLPs Rep-PCR PFGE e DGGE Sequências de DNA Laboratórios Biomoleculares I MJC - T

14 RFLPs Restriction Fragment Length Polymorphism – Usa enzimas de restrição – Análise dos fragmentos produzidos Pode ser combinada com sondas específicas Laboratórios Biomoleculares I MJC - T

15 rep-PCR PCR para zonas conservadas repetitivas da maioria das G- e algumas G+ – Repetitive Extragenic Palindromic (REP) (35 40 pbs) – Enterobacterial repetitive intergenic consensus (ERIC) ( pbs) – Box (154 pbs) Laboratórios Biomoleculares I MJC - T

16 PFGE e DGGE Pressupõe PCR anterior para geração dos fragmentos São técnicas apenas de separação dos fragmentos de DNA Laboratórios Biomoleculares I MJC - T

17 Sequências de DNA Obter fragmentos de DNA do microrganis mo Fazer o seu sequencia mento As sequências podem ser obtidas por clonagem ou por amplificaçã o de PCR Laboratórios Biomoleculares I MJC - T

18 Técnica de PCR Forma muito comum de obter os fragmentos para análise. O que determina a especificidade da reacção de PCR? Laboratórios Biomoleculares I MJC - T

19 Desenho de primers? Qual o objectivo? Quais os cuidados a ter? – Temperaturas de melting e anneeling. – Complementaridade dos primers Laboratórios Biomoleculares I MJC - T

20 Temperatura de Melting TM= 2*(A+T) + 4*(G+C) GCCAACAGAATCCTTCTTGA GGTCTCTGTGCATTGACCTT TM= 58ºC Laboratórios Biomoleculares I MJC - T

21 Objectivo pretendido neste módulo Identificação de bactérias do biofilme oral Laboratórios Biomoleculares I MJC - T Artigos na pasta do molar. Que sequências se vão ampliar em cada bactéria? Qual a sensibilidade e especificidade do teste? Que concentrações de cada uma das espécies de Streptococcus conseguem ser identificadas? Objectivo para a próxima aula Saber que soluções temos de preparar


Carregar ppt "Licenciatura em Ciências Biomédicas Laboratórios Biomoleculares I Módulo II 2011/2012."

Apresentações semelhantes


Anúncios Google