A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

1 André de Carvalho LABIC Utilizando Inteligência Artificial em Bioinformática Prof. André de Carvalho LABIC - Universidade de São Paulo.

Apresentações semelhantes


Apresentação em tema: "1 André de Carvalho LABIC Utilizando Inteligência Artificial em Bioinformática Prof. André de Carvalho LABIC - Universidade de São Paulo."— Transcrição da apresentação:

1

2 1 André de Carvalho LABIC Utilizando Inteligência Artificial em Bioinformática Prof. André de Carvalho LABIC - Universidade de São Paulo

3 2 André de Carvalho LABIC Principais tópicos Introdução Bioinformática Biologia Molecular Reconhecimento de Genes Utilizando Inteligência Artificial Conclusão

4 3 André de Carvalho LABIC IA e Bioinformática BIOLOGIA Redes Neurais, Algorítmos genéticos COMPUTAÇÃO Bioinformática

5 4 André de Carvalho LABIC Definições Bioinformática Pesquisa e desenvolvimento de ferramentas computacionais, matemáticas e estatísticas para a resolução de problemas da Biologia Biologia molecular A Computação está para a Biologia da mesma forma que a Matemática está para a Física. Harold Morowitz

6 5 André de Carvalho LABIC Bioinformática Nos últimos anos, diversos laboratórios têm trabalhado no seqüenciamento de vários genomas Até o ano 2000: Mais que 30 organismos tinham sido seqüenciados Cerca de 150 organismos estavam sendo seqüenciados Determinação da seqüência de nucleotídeos em uma molécula é o primeiro passo para entender seu funcionamento Beneficia várias áreas Medicina - Farmácia - Agricultura

7 6 André de Carvalho LABIC Crescimento do GenBank

8 7 André de Carvalho LABIC Andamento de projetos genoma 73 genomas completos publicados Humano Camundongo Drosophila Arabidopsis Levedura 212 de procariotos em andamento 157 de eucariotos em andamento

9 8 André de Carvalho LABIC Fração do genoma da levedura CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTGGCCAACCTGTCTCTCAACTTACCC TCCATTACCCTGCCTCCACTCGTTACCCTGTCCCATTCAACCATACCACTCCGAACCACCATCCATCCCTCTACTTACTACCACTCACCCACCGTTACCCTCCAATTACCCATATCCAACCCAC TGCCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATACTGTTCTTCTACCCACCATATTGAAACGCTAACAAATGATCGTAAATAACACACACGTGCTTACCCTACCACT TTATACCACCACCACATGCCATACTCACCCTCACTTGTATACTGATTTTACGTACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTCTCAGATTCCACTTCACTCCATGGC CCATCTCTCACTGAATCAGTACCAAATGCACTCACATCATTATGCACGGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATTTTGATATCTATAT CTCATTCGGCGGTCCCAAATATTGTATAACTGCCCTTAATACATACGTTATACCACTTTTGCACCATATACTTACCACTCCATTTATATACACTTATGTCAATATTACAGAAAAATCCCCACAA AAATCACCTAAACATAAAAATATTCTACTTTTCAACAATAATACATAAACATATTGGCTTGTGGTAGCAACACTATCATGGTATCACTAACGTAAAAGTTCCTCAATATTGCAATTTGCTTGAA CGGATGCTATTTCAGAATATTTCGTACTTACACAGGCCATACATTAGAATAATATGTCACATCACTGTCGTAACACTCTTTATTCACCGAGCAATAATACGGTAGTGGCTCAAACTCATGCGGG TGCTATGATACAATTATATCTTATTTCCATTCCCATATGCTAACCGCAATATCCTAAAAGCATAACTGATGCATCTTTAATCTTGTATGTGACACTACTCATACGAAGGGACTATATCTAGTCA AGACGATACTGTGATAGGTACGTTATTTAATAGGATCTATAACGAAATGTCAAATAATTTTACGGTAATATAACTTATCAGCGGCGTATACTAAAACGGACGTTACGATATTGTCTCACTTCAT CTTACCACCCTCTATCTTATTGCTGATAGAACACTAACCCCTCAGCTTTATTTCTAGTTACAGTTACACAAAAAACTATGCCAACCCAGAAATCTTGATATTTTACGTGTCAAAAAATGAGGGT CTCTAAATGAGAGTTTGGTACCATGACTTGTAACTCGCACTGCCCTGATCTGCAATCTTGTTCTTAGAAGTGACGCATATTCTATACGGCCCGACGCGACGCGCCAAAAAATGAAAAACGAAGC AGCGACTCATTTTTATTTAAGGACAAAGGTTGCGAAGCCGCACATTTCCAATTTCATTGTTGTTTATTGGACATACACTGTTAGCTTTATTACCGTCCACGTTTTTTCTACAATAGTGTAGAAG TTTCTTTCTTATGTTCATCGTATTCATAAAATGCTTCACGAACACCGTCATTGATCAAATAGGTCTATAATATTAATATACATTTATATAATCTACGGTATTTATATCATCAAAAAAAAGTAGT TTTTTTATTTTATTTTGTTCGTTAATTTTCAATTTCTATGGAAACCCGTTCGTAAAATTGGCGTTTGTCTCTAGTTTGCGATAGTGTAGATACCGTCCTTGGATAGAGCACTGGAGATGGCTGG CTTTAATCTGCTGGAGTACCATGGAACACCGGTGATCATTCTGGTCACTTGGTCTGGAGCAATACCGGTCAACATGGTGGTGAAGTCACCGTAGTTGAAAACGGCTTCAGCAACTTCGACTGGG TAGGTTTCAGTTGGGTGGGCGGCTTGGAACATGTAGTATTGGGCTAAGTGAGCTCTGATATCAGAGACGTAGACACCCAATTCCACCAAGTTGACTCTTTCGTCAGATTGAGCTAGAGTGGTGG TTGCAGAAGCAGTAGCAGCGATGGCAGCGACACCAGCGGCGATTGAAGTTAATTTGACCATTGTATTTGTTTTGTTTGTTAGTGCTGATATAAGCTTAACAGGAAAGGAAAGAATAAAGACATA TTCTCAAAGGCATATAGTTGAAGCAGCTCTATTTATACCCATTCCCTCATGGGTTGTTGCTATTTAAACGATCGCTGACTGGCACCAGTTCCTCATCAAATATTCTCTATATCTCATCTTTCAC ACAATCTCATTATCTCTATGGAGATGCTCTTGTTTCTGAACGAATCATAAATCTTTCATAGGTTTCGTATGTGGAGTACTGTTTTATGGCGCTTATGTGTATTCGTATGCGCAGAATGTGGGAA TGCCAATTATAGGGGTGCCGAGGTGCCTTATAAAACCCTTTTCTGTGCCTGTGACATTTCCTTTTTCGGTCAAAAAGAATATCCGAATTTTAGATTTGGACCCTCGTACAGAAGCTTATTGTCT AAGCCTGAATTCAGTCTGCTTTAAACGGCTTCCGCGGAGGAAATATTTCCATCTCTTGAATTCGTACAACATTAAACGTGTGTTGGGAGTCGTATACTGTTAGGGTCTGTAAACTTGTGAACTC TCGGCAAATGCCTTGGTGCAATTACGTAATTTTAGCCGCTGAGAAGCGGATGGTAATGAGACAAGTTGATATCAAACAGATACATATTTAAAAGAGGGTACCGCTAATTTAGCAGGGCAGTATT ATTGTAGTTTGATATGTACGGCTAACTGAACCTAAGTAGGGATATGAGAGTAAGAACGTTCGGCTACTCTTCTTTCTAAGTGGGATTTTTCTTAATCCTTGGATTCTTAAAAGGTTATTAAAGT TCCGCACAAAGAACGCTTGGAAATCGCATTCATCAAAGAACAACTCTTCGTTTTCCAAACAATCTTCCCGAAAAAGTAGCCGTTCATTTCCCTTCCGATTTCATTCCTAGACTGCCAAATTTTT CTTGCTCATTTATAATGATTGATAAGAATTGTATTTGTGTCCCATTCTCGTAGATAAAATTCTTGGATGTTAAAAAATTATTATTTTCTTCATAAAGAAGCTTTCAAGATATAAGATACGAAAT AGGGGTTGATAATTGCATGACAGTAGCTTTAGATCAAAAAGGAAAGCATGGAGGGAAACAGTAAACAGTGAAAATTCTCTTGAGAACCAAAGTAAACCTTCATTGAAGAGCTTCCTTAAAAAAT TTAGAATCTCCCATGTCAACGGGTTTCCATACCTCCCCAGCATCATACATCTTTTTTCAAAGAAACTTCAAATGCCTCTTTTATGCAAGGGGCAAAATCCTGAAATGACTTAAACTTAGCAGTT TCGTCTTTTTTCAAAGAGAATGGTTGAAGAAGAATTGTTTTGGACGCTTATTGACAATCTGTTGCATTGATAAAGTACCTACTATCCCAGACTATATTTGTATACAAGTACAAAATTAGGTTTG TTGAAACAACTTTCCGATCATTGGTGCCCGTATCTGATGTTTTTTTAGTAATTTCTTTGTAAATACAGGGAGTTGTTTCGAAAGCTTATGAGAAAAATACATGAATGACAGGTAAAAATATTGG CTCGAAAAAGAGGACAAAAAGAGAAATCATAAATGAGTAAACCCACTTGCTGGACATTATCCAGTAAAGGCTTGGTAGTAACCATAATATTACCCAGGTACGAAACGCTAAGAACCTTGAAAGA CTCATAAAACTTCCAGGTTAAGCTATTTTTGAAAATATTCTGAGGTAAAAGCCATTAAGGTCCAGATAACCAAGGGACAATAAACCTATGCTTTTCTTGTCTTCAATTTCAGTATCTTTCCATT TTGATAATGAGCATGTGATCCGGAAAGCTACTTTATGATGTTTCAAGGCCTGAAGTTTGAATATTTATGTAGTTCAACATCAAATGTGTCTATTTTGTGATGAGGCAACCGTCGACAACCTTAT TATCGAAAAAGAACAACAAGTTCACATGCTTGTTACTCTCTATAACTAGAGAGTACTTTTTTTGGAAGCAAGTAAGAATAAGTCAATTTCTACTTACCTCATTAGGGAAAAATTTAATAGCAGT TGTTATAACGACAAATACAGGCCCTAAAAAATTCACTGTATTCAATGGTCTACGAATCGTCAATCGCTTGCGGTTATGGCACGAAGAACAATGCAATAGCTCTTACAAGCCACTACATGACAAG CAACTCATAATTTAA

10 9 André de Carvalho LABIC Bioinformática Ênfase está se deslocando progressivamente da acumulação de dados para a sua interpretação Com os seqüenciamentos realizados, uma grande quantidade de dados tem sido gerada Estes dados precisam agora ser analisados Análise laboratorial destes dados é difícil e cara Ferramentas computacionais sofisticadas são necessárias para a análise dos dados obtidos

11 10 André de Carvalho LABIC Bioinformática Para muitas destas análises, as ferramentas computacionais precisam lidar com dados imprecisos e ruidosos Técnicas de laboratório de Biologia Molecular quase sempre geram dados com erros ou imprecisões Na medição dos valores ou definição das classes Inteligência Artificial fornecem técnicas eficientes para lidar com problemas deste tipo

12 11 André de Carvalho LABIC Biologia Molecular Estudo das células e moléculas Em particular: genoma dos organismos Estruturas principais: Genes Cromossomos DNA RNA Proteínas nucleotídeos aminoácidos Expressão Gênica

13 12 André de Carvalho LABIC Biologia Molecular Dogma central da Biologia Molecular Transferência de Informação Transcrição Tradução DNA RNA Proteínas Replicação

14 13 André de Carvalho LABIC Biologia Molecular Algumas descobertas posteriores contradizem este dogma: RNA pode sofrer replicação em alguns vírus e plantas RNA viral, através de uma enzima denominada transcriptase reversa, pode ser transcrito em DNA DNA pode traduzir diretamente proteínas específicas Sem passar pelo processo de transcrição

15 14 André de Carvalho LABIC Biologia Molecular DNA (Ácido Desoxirribonucleico) O DNA é uma molécula formada por duas fitas (dupla fita) que se entrelaçam formando uma hélice dupla DNA é composto de quatro nucleotídeos diferentes Adenina, Citosina, Guanina e Timina Fitas são mantidas juntas por ligações que conectam cada nucleotídeo de uma fita ao seu complemento na outra A se liga com T e C se liga com G

16 15 André de Carvalho LABIC Biologia Molecular Genes Subseqüências de DNA Localizados no cromossomo Servem como molde para a produção de proteínas Encaixadas entre os genes estão segmentos chamados de regiões não codificadoras

17 16 André de Carvalho LABIC Biologia Molecular Proteínas Definem estrutura, função e mecanismos regulatórios das células Exemplos de mecanismos regulatórios: controle do ciclo celular, transcrição gênica Seqüências lineares Combinações de 20 aminoácidos diferentes Três nucleotídeos (codon) formam um aminoácido

18 17 André de Carvalho LABIC Biologia Molecular

19 18 André de Carvalho LABIC Biologia Molecular Expressão gênica Processo pelo qual genes são usados para produzir proteínas Mecanismos de expressão gênica são diferentes para organismos: Eucariotos Material genético difuso nas células (Ex.: bactérias) Procariotos Material genético em um núcleo (Ex.: seres humanos)

20 19 André de Carvalho LABIC Processo de expressão gênica Transcrição RNA polimerase é a molécula (enzima) que transcreve DNA em RNA RNA polimerase começa a transcrição após se ligar a um sinal regulatório no DNA chamado promotor Gera molécula de RNA mensageiro (mRNA)

21 20 André de Carvalho LABIC Processo de expressão gênica Transcrição depende do organismo Organismos eucariotos Cada gene é transcrito independentemente Existe um promotor antes de todo gene Organismos procariotos Vários genes consecutivos podem ser transcritos em uma única molécula de RNA Não existe necessariamente um promotor antes de cada gene

22 21 André de Carvalho LABIC Processo de expressão gênica Tradução Sintetiza uma proteína utilizando como forma mRNA Leitura do mRNA é feita por uma molécula chamada de ribossomo Mensagem lida é utilizada para montar uma cadeia de proteína Tripla de nucleotídeos consecutivos (codon) codifica um aminoácido Código genético: mapeamento de codons em aminoácidos

23 22 André de Carvalho LABIC Processo de expressão gênica G C A G C T C C G G A C T C C A T... RNA Polimerase promotor Transcrição DNA mRNA A T

24 23 André de Carvalho LABIC Processo de expressão gênica T G C A G C T C C G G A C T C C A T... RNA Polimerase promotor Transcrição A C G U C G A G G C C U G A G G U A... DNA mRNA

25 24 André de Carvalho LABIC Processo de expressão gênica T G C A G C T C C G G A C T C C A T... RNA Polimerase promotor Transcrição A C G U C G A G G C C U G A G G U A... DNA mRNA Tradução Thr Ribossomo A C G

26 25 André de Carvalho LABIC Processo de expressão gênica T G C A G C T C C G G A C T C C A T... RNA Polimerase promotor Transcrição A C G U C G A G G C C U G A G G U A... DNA mRNA Tradução Ribossomo His LeuGly Ser Cys

27 26 André de Carvalho LABIC Processo de expressão gênica Estrutura de leitura Para uma dada faixa de DNA, nucleotídeos podem ser agrupados em triplas de três formas diferentes Um dos nucleotídeos pode ocupar a 1 a, 2 a ou 3 a posição em um codon Apenas um destes três possíveis agrupamentos é realmente lido pelo ribossomo O agrupamento lido é chamado de estrutura de leitura do gene A T T A C G A A G

28 27 André de Carvalho LABIC Processo de expressão gênica Em organismos eucariotos, existe um outro passo importante durante o processo de expressão gênica Após o DNA ser transcrito, certas partes da molécula são eliminadas antes de sua transformação em proteína Genes em eucariotos são formados por segmentos alternados de exons e introns

29 28 André de Carvalho LABIC Regiões de splice Exons: Seqüências de nucleotídeos que são expressas (traduzidas em proteínas) Introns: Seqüências intercaladas que são eliminadas na tradução Regiões de splice (splice-junctions): Pontos de fronteira onde ocorrem junções de exons e introns Doadoras: bordas exon-intron Aceptoras: bordas intron-exon

30 29 André de Carvalho LABIC Splice-junctions mRNA intron exon Splicing DNA Transcrição mRNA doador aceptor

31 30 André de Carvalho LABIC Biologia Molecular e IA Problemas da Biologia Molecular que podem ser tratados por IA Reconhecimento de genes Construção de árvores filogenéticas Análise de expressão gênica Previsão de estruturas de proteínas Análise de interação entre genes Montagem de fragmentos Alinhamento de seqüências

32 31 André de Carvalho LABIC Reconhecimento de genes Um dos principais problemas em biologia molecular é a identificação de genes em seqüências de DNA não caracterizadas Algoritmos convencionais não têm sido eficientes Variação natural dos genes Complexidade dos genes Natureza pouco compreendida dos genes Abordagem promissora: Aprendizado de Máquina

33 32 André de Carvalho LABIC Reconhecimento de genes Duas abordagens principais têm sido seguidas: Busca por sinal Busca por conteúdo

34 33 André de Carvalho LABIC Reconhecimento de genes Busca por sinal Localiza genes indiretamente Procura sinais particulares relacionados com a expressão de genes Sinal Região localizada do DNA que realiza uma função específica (exemplo: se liga a uma enzima)

35 34 André de Carvalho LABIC Reconhecimento de genes Busca por conteúdo Reconhece genes diretamente Identifica segmentos de seqüências de DNA que possuem as propriedades gerais de regiões codificadoras Se baseia no conhecimento das diferentes propriedades estatísticas de regiões codificadoras e não codificadoras

36 35 André de Carvalho LABIC Busca por sinal É importante não apenas entender a função de cada gene Mas também os mecanismos que regulam a expressão do gene Vários sinais exercem importantes funções regulatórias definindo: Condições sob as quais os genes são expressos Taxa com a qual a expressão ocorre

37 36 André de Carvalho LABIC Busca por sinal Detecção de sinal já é um problema em si Vários sinais que podem ser identificados em seqüências de nucleotídeos são importantes para a identificação de genes Sítios de i nício de transcrição (promotores) Sítios de término de transcrição (terminadores) Sítios de splice-junction Sítios de início da tradução (codons de iniciação) Sítios de término da tradução (codons de parada ou stop codons)

38 37 André de Carvalho LABIC Busca por sinal Diferentes sinais têm diferentes dificuldades de identificação Codons de parada são facilmente identificados Identificação de outros sinais é mais complicada Busca por sinal é uma tarefa de classificação Dada uma janela de tamanho fixo de um DNA, determinar se ela contém um sinal de interesse Se uma característica identificável do sinal ocupa uma posição particular na janela

39 38 André de Carvalho LABIC Busca por sinal Promotor na posição 3? Classificador Posição 1 = C Posição 2 = T Posição 3 = T Posição 4 = A Posição 5 = C Posição 6 = G Representação das características Seqüência de DNA... A T C G T G C T T A C G C G T C C A

40 39 André de Carvalho LABIC Reconhecimento de início da tradução Reconhece codons de iniciação Tradução de mRNA em proteína não começa com sua primeira tripla de nucleotídeos Em organismos procariotos, uma simples molécula de mRNA pode ter vários sítios de início de tradução Genes consecutivos podem ser transcritos em uma única cadeia de mRNA

41 40 André de Carvalho LABIC Reconhecimento de promotores Sinal regulatório de uma molécula de DNA onde RNA polimerase se liga para começar a transcrição RNA polimerase é uma molécula que transcreve DNA em RNA Auxilia na localização de genes no DNA Existem sítios amplamente aceitos como sendo as regiões que fornecem as carecterísticas definidoras de promotores Regiões 10 e 35

42 41 André de Carvalho LABIC Busca pelo conteúdo Identifica genes reconhecendo padrões que que ocorrem na sua seqüência de nucleotídeos Regiões do DNA que serão traduzidas em proteínas Organismos procariotos: distinguir genes de regiões não codificadoras Organismos eucariotos: distinguir também introns de exons Janelas de tamanho fixo também são utilizadas para esta previsão

43 42 André de Carvalho LABIC Busca pelo conteúdo Busca por conteúdo procura responder as seguintes perguntas: Quais são as regiões codificadoras Para uma dada região, que faixa e qual estrutura de leitura codifica a proteína Várias propriedades podem ser exploradas para distinguir regiões codificadoras de não codificadoras

44 43 André de Carvalho LABIC Busca pelo conteúdo Propriedades que podem ser exploradas: Alguns aminoácidos são usados mais freqüentemente que outros em regiões codificadoras A existência de diferentes números de codons para aminoácidos diferentes Codons que mapeiam em um dado aminoácido não são usados igualmente na maioria dos organismos Não podem conter codons de parada Alguns codons têm maior probabilidade de serem vizinhos

45 44 André de Carvalho LABIC Reconhecimento de genes Abordagens mais promissoras em reconhecimento de genes: Combinam previsão de vários sinais diferentes e regiões codificadoras Reconhecimento de operons Genes consecutivos que são ativados ou desativados em conjunto

46 45 André de Carvalho LABIC Redes Neurais Artificiais Sistemas computacionais distribuídos baseados na estrutura e funcionamento do sistema nervoso Nodos simulam neurônios Conexões ponderadas simulam sinapses Definidas por Arquitetura Aprendizado

47 46 André de Carvalho LABIC Redes Neurais Artificiais camada de entrada camadas intermediárias camada de saída conexões

48 47 André de Carvalho LABIC Redes Neurais Artificiais Stormo et al (1982): reconhecimento de sítios de início de tradução no DNA de bactérias E. Coli Primeira aplicação de Redes Neurais em Bioinformática Utilizou rede Perceptron... A T C G T G C T T A C G C G C G T... A CG T A CG T A CG T

49 48 André de Carvalho LABIC Reconhecimento de regiões de splicingRampone (1998) Reconhecimento de promotoresMa e Wang (1999) Bajic et al. (2002) Previsão de estrutura de proteínasRiis et al (1995) Polyac et al (1992) Servidor GRAIL - identificação de genesUberbacher et al (1993) Sítios de início de transcriçãoTowell et al (1990) Problema abordadoTrabalho Redes Neurais Artificiais

50 49 André de Carvalho LABIC Algoritmos Genéticos Técnica de busca e otimização Baseados na genética e teoria da seleção natural Utiliza uma população de soluções candidatas (indivíduos) A cada indivíduo é associado um escore de aptidão, que mede o quão boa é a solução que ele representa Otimização ocorre em várias gerações A cada geração Mecanismos de seleção selecionam os indivíduos mais aptos Operadores de reprodução geram novos indivíduos

51 50 André de Carvalho LABIC Algoritmos Genéticos População atual Reprodução Avaliação Seleção População inicialPopulação final

52 51 André de Carvalho LABIC Algoritmos Genéticos Alinhamento de seqüências: Uma a uma Uma com várias Identificar: Inserções Remoções Substituições Seq 1 : A G C C A T A T Seq 2 : A C G C T A T A Seq 1 : A G C C A T A T Seq 2 : A C G C T A T A

53 52 André de Carvalho LABIC Algoritmos Genéticos Alinhamento de sequênciasZhang e Wong (1997) Previsão de estrutura de proteínas Alander (1995) Krasnogor et al. (1999) Problema abordadoTrabalho

54 53 André de Carvalho LABIC Raciocínio Baseado em Casos Resolve novos problemas adaptando soluções de problemas anteriores semelhantes Nova solução Novo problema 1 2 Solução Problema Solução Problema

55 54 André de Carvalho LABIC Raciocínio Baseado em Casos RBC é mais que uma Base de Dados Não é uma tabela de busca Sistemas de RBC procuram casos passados semelhantes ao problema atual em uma base de casos indexada Indexação e representação de casos facilitam recuperação de casos relevantes e sua comparação com o problema atual Permite adaptação de casos

56 55 André de Carvalho LABIC Raciocínio Baseado em Casos Ciclo de um sistema de RBC (Aamodt, 1993)

57 56 André de Carvalho LABIC Raciocínio Baseado em Casos Alinhamento de seqüênciasHarris et al. (1993) Reconhecimento de genesShavlik (1990, 1991) Problema abordadoTrabalho

58 57 André de Carvalho LABIC Classificadores de Margens Largas Maximizam a margem de separação entre classes presentes nos dados Máquinas de Vetores Suporte (SVMs) Boosting Maior capacidade de generalização Baseados na Teoria de Aprendizado EstatísticoVapnik e Chervonenkis (1968) Embute conceitos probabilísticos e estatísticos

59 58 André de Carvalho LABIC Classificadores de Margens Largas Máquinas de Vetores Suporte Encontra um hiperplano ótimo que separa classes em um espaço abstrato margem Classe 1 Classe 2

60 59 André de Carvalho LABIC Classificadores de Margens Largas Análise de expressão gênica Expressão Tecido normalTecido com tumor GeneT1 T2 T3T1 T2 T

61 60 André de Carvalho LABIC Classificadores de Margens Largas Promotores, reg. codificadorasAB, RNsJackson (1995) DNA microarraySVMs, ADsBrown et al. (1999) Subfamílias proteínasSVMsKarchin et al. (2002) Especificidade proteínasADs, ABHuss et al. (2001) Bem-Hur et al. (2000) Furey et al. (2001) Zien et al. (2000) Ding e Dubchak (2001) Trabalho DNA microarraySVMs, AB, clusterização DNA microarraySVMs Sítios de início de traduçãoSVMs Estrutura proteínasSVMs, RNs Problema abordadoTécnicas

62 61 André de Carvalho LABIC Árvores de Decisão Organizam informações em estrutura composta de nós e ramificações Nós: testes sobre atributos; Ramos: resultados dos testes sorri segurainimigo não sim inimigoamigo espada balão ou bandeira

63 62 André de Carvalho LABIC Árvores de Decisão Lapedes et al (1989): detecção de regiões de splicing (regiões doadoras) Entrada: cadeia de nucleotídeos Positivo Posição 8 = ? Posição 3 = ? Negativo Posição 9 = ? A C G T A C G T Negativo Positivo A C G T Negativo

64 63 André de Carvalho LABIC Outras técnicas Eddy (1998)Detecção de genesCadeias de Markov Guan et al (1994)Estrutura de proteínas RNAs, AGs e k- NN Dond e Searls (1994) Previsão da estrutura de genes Lingüística computacional Friedman et al (2000) Detecção de genesRedes Baysianas TrabalhoProblemaTécnica

65 64 André de Carvalho LABIC Projeto Fapesp Genoma Clínico Genoma do câncer humano Dados clínicos e de expressão gênica Sage, PCR, Microarray e MPSS 9 tipos de câncer Análise de expressão gênica Data mining Utiliza técnicas de Aprendizado de Máquina FAPESP e Instituto Ludwig

66 65 André de Carvalho LABIC Projeto CNPq - Bioinformática Reconhecimento de genes Identificação de promotores Reconhecimento de regiões de splicing Reconhecimento de regiões codificadoras Utiliza SVMs, AB e RNs Metodologias para melhorar desempenho Redução de ruídos Seleção de atributos CNPq e FAPESP

67 66 André de Carvalho LABIC Projeto CNPq - Bioinformática Melhoramento genético Utiliza marcadores moleculares para avaliar potencial genético 10 marcadores (2 já foram avaliados) Identificação de cruzamentos mais promissores Previsão de ganho de peso entre nascimento e desmama Utiliza SVMs e RNs CNPq e Embrapa

68 67 André de Carvalho LABIC Referências de IA e Bioinformática Artificial Intelligence and Molecular Biology Editado por Lawrence Hunter, AAAI Press Book Disponível gratuitamente na internet Bioinformatics (Adaptive Computation and Machine Learning) Pierre Baldi, Soren Brunak, Sren Brunak, MIT Press Neural Networks and Genome Informatics Cathy H. Wu, Jerry W. McLarty, Elssevier Data Analysis and Classification for Bioinformatics Arun Jagota

69 68 André de Carvalho LABIC Conclusão Introdução Bioinformática Biologia Molecular Reconhecimento de Genes Utilização de IA em Bioinformática

70 69 André de Carvalho LABIC Agradecimentos Ana Carolina Lorena Cláudia Regina Milaré Humberto de Sousa Silvia Gorla Modonese da Silva Alexandre Delbem Katti Faceli Welington Martins

71 70 André de Carvalho LABIC Reconhecimento de regiões de splicing Dados Dados: regiões de splicing de primatas (UCI) Divisão do problema Divisão do problema: Identificação de presença da região (Experimento 1) Determinação do tipo da região (Experimento 2) intron-exon exon-intron Técnicas: Árvores de Decisão (ADs) Redes Neurais Artificiais (RNAs) Máquinas de Vetores Suporte (SVMs)

72 71 André de Carvalho LABIC Pré-processamento dos dados Heurística Tomek links Heurística Tomek links: identificar Dados classificados incorretamente Borderlines % dados

73 72 André de Carvalho LABIC Resultados ADs: ADs: diminuição do tamanho das árvores induzidas ( %) RNAs: RNAs: menor tempo de treinamento (20 %) SVMs: SVMs: menor tempo de treinamento ( %) menor número de vetores suporte ( %)

74 73 André de Carvalho LABIC Experimento 2 Erros obtidos (%) Pré-proc Originais EIIETotalNIE+EITotalDados Pré-proc Originais Pré-proc Originais Experimento 1 ADAD RNARNA SVMSVM

75 74 André de Carvalho LABIC Teste de Significância 95 % ADSVM Pré-processadosOriginaisTécnica 2Técnica 1 80 %--ADRNA 95 % ADSVM 95 % RNASVM Pré-processadosOriginaisTécnica 2Técnica 1 Significância com que Técnica 1 é melhor que Técnica 2 Experimento 1: Experimento 2:

76 75 André de Carvalho LABIC Análise de expressão gênica Várias medidas foram testadas para a seleção de genes Para as várias medidas foram selecionados 50, 10 e 4 genes, sendo metade hipo e metade hiper expressos Para os casos 10 e 4 genes, os genes foram selecionados dentre aqueles com expressão > 5 (apenas 84 genes)

77 76 André de Carvalho LABIC Experimentos Os genes selecionados foram utilizados em um algoritmo de Aprendizado de Máquina (AM) AM utilizado para classificar se uma amostra é de tecido normal ou com tumor, a partir dos dados de expressão desses genes Objetivo: verificar quais entre várias medidas para seleção dos genes forneceu um conjunto de genes mais apropriado para a distinção tumor/normal

78 77 André de Carvalho LABIC Bibliotecas empregadas Normal 1 - SAGE_Brain_normal_cerebellum_B_1_FREQUENCY 2 - SAGE_Brain_normal_cerebellum_B_BB542_FREQUENCY 3 - SAGE_Brain_normal_cortex_B_BB542_FREQUENCY 4 - SAGE_Brain_normal_cortex_B_pool6_FREQUENCY 5 - SAGE_Brain_normal_peds_cortex_B_H1571_FREQUENCY 6 - SAGE_Brain_normal_thalamus_B_1_FREQUENCY Tumor 7 - SAGE_Brain_astrocytoma_gradeIII_B_H1020_FREQUENCY 8 - SAGE_Brain_ependymoma_B_239_FREQUENCY 9 - SAGE_Brain_glioblastoma_B_GBM1062_FREQUENCY 10 - SAGE_Brain_glioblastoma_CL_H54+EGFRvIII_FREQUENCY 11 - SAGE_Brain_glioblastoma_CL_H54+LacZ_FREQUENCY 12 - SAGE_Brain_medulloblastoma_B_96-04-P019_FREQUENCY 13 - SAGE_Brain_medulloblastoma_B_98-04-P494_FREQUENCY 14 - SAGE_Brain_medulloblastoma_B_98-05-P608_FREQUENCY

79 78 André de Carvalho LABIC Resultados Classificações incorretas Fórmula 4 genes10 genes50 genes Medida 010 B (Difference) 000 A (Ratio) 010 D (Difference) 000E 010 F (correlação de Pearson) 210 I (Distância Euclidiana) 010 H (Baseado em C e D) 010 G (Baseado em A e B) 000 C (Ratio) Se senão

80 79 André de Carvalho LABIC Genes selecionados com as várias medidas TAGUNIGENE No. de vezes que foi selecionado Descrição AAGTTGCTAT Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy) AGGCTACGGA ribosomal protein L13a ATGTGAAGAG secreted protein, acidic, cysteine-rich (osteonectin) ATTTGAGAAG RAD23 homolog B (S. cerevisiae) CACCTAATTG FLJ23277 protein CCACTGCACT enhancer of invasion 10 CCTGTAATCC '-nucleotidase (purine), cytosolic type B CTGGGTTAAT ribosomal protein S19 GAGGGAGTTT760648ribosomal protein L27a GGCAAGCCCC ribosomal protein L10a GGCTGGGGGC757213profilin 1 GGGCTGGGGT904362sperm associated antigen 7 GTGAAACCCC hypothetical protein MGC3207 GTGAAACCCT hypothetical protein PP1226 GTGAAGGCAG770393ribosomal protein S3A GTTGTGGTTA754151beta-2-microglobulin TACCATCAAT glyceraldehyde-3-phosphate dehydrogenase TACTAGTCCT heat shock 90kD protein 1, alpha TAGGTTGTCT tumor protein, translationally-controlled 1 TGCACGTTTT ribosomal protein L32 TGCCTGCACC cystatin C (amyloid angiopathy and cerebral hemorrhage) TGGAGTGGAG37642guanylate kinase 1 TGTACCTGTA tubulin, alpha, ubiquitous TTGGGGTTTC629541ferritin, heavy polypeptide 1


Carregar ppt "1 André de Carvalho LABIC Utilizando Inteligência Artificial em Bioinformática Prof. André de Carvalho LABIC - Universidade de São Paulo."

Apresentações semelhantes


Anúncios Google