A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Alinhamento de Seqüências Genéticas Daniel Guariz Pinheiro, PhD. Laboratório de Genética Molecular e Bioinformática Departamento de Genética Faculdade.

Apresentações semelhantes


Apresentação em tema: "Alinhamento de Seqüências Genéticas Daniel Guariz Pinheiro, PhD. Laboratório de Genética Molecular e Bioinformática Departamento de Genética Faculdade."— Transcrição da apresentação:

1 Alinhamento de Seqüências Genéticas Daniel Guariz Pinheiro, PhD. Laboratório de Genética Molecular e Bioinformática Departamento de Genética Faculdade de Medicina de Ribeirão Preto Universidade de São Paulo Fevereiro-2011

2 SEQÜÊNCIAS GENÉTICAS Introdução

3 Seqüenciamento de DNA Gilbert & Sanger -Métodos para o seqüenciamento de DNA - Seqüenciador semi-automático Leroy Hood Seqüenciador automático comercial Roche/454 FLXABI SOLiD Illumina/Solexa Genome Analyzer Helicos HeliScope 2008 Applied Biosystems 2010 Pacific Biosciences ION Torrent

4 Nova Geração de Seqüenciadores de DNA Roche/454 FLX Illumina/Solexa GA ABI SOLiD ABI 3730xl Roche/454 FLXIllumina/Solexa GAABI SOLiD MétodoSangerPiroseqüenciamentoSeqüenciamento por Síntese Seqüenciamento por Ligação Dados/run290 Kb~300 Mb~7 Gb> 15 Gb Tempo/run1 hora5 horas3-7 dias10 dias Tamanho~ pb~ pb~ pb~ pb Custo/run$48$6.800$9.300$ Runs Genoma 3Gb ($ ) 360 ($ ) 59 ($ ) 30 ($ ) Adapted from Richard Wilson, School of Medicine, Washington University, Sequencing the Cancer Genome

5 Pares de baseSeqüências

6 Sequence Read Archive (…) In mid-September 2010, the SRA contained >500 billion reads consisting of 60 trillion base pairs available for download (…) Almost 80% of the sequencing data are derived from the Illumina GA platform. The SOLiD and Roche/454 platforms account for 15% and 5% of submitted base pairs, respectively.(…) (Leinonen R et. al., 2011) Were growing by about 1 Tb/month. NCBIs staff scientist Martin Shumway

7 Formato Fasta >SEQUENCE_1 cagtcagcatactcagtcagtcatgcatgctga gtcacttgcatgacgtcatgactgcatgactgc sequence.fa Extensões:.fa,.fasta,.fna >SEQUENCE_ sequence.qual

8 Qualidade O que queremos dizer com qualidade ? >SEQUENCE_ ScoreP erro

9 Formato AGTACAAGAGACAGACATTCTTTTTTTTGACACAAG +SOLEXA01:1:1:27:1992#0/1 \FFFMXPYDDHJSUMVUJLPSNFRXZEDLNLHKHIT Formato fastq sequence.fastq Extensões:.fastq Qualidade codificada como um único caracter da tabela ASCII. SOLEXA01 the unique instrument name 1 flowcell lane 1 tile number within the flowcell lane 27 'x'-coordinate of the cluster within the tile 1992 'y'-coordinate of the cluster within the tile #0 index number for a multiplexed sample (0 for no indexing) /1 the member of a pair, /1 or /2 (paired-end or mate-pair reads only)

10 ATRIBUINDO SIGNIFICADO ÀS SEQÜÊNCIAS Introdução

11 Há uma referência? Reseqüenciamento – Existem seqüências produzidas a partir de um genoma/transcriptoma da mesma espécie da amostra ou de uma espécie relacionada que podem ser usadas como referências. Alinhamento com a referência. Seqüenciamento de novo – Não há seqüências que podem ser usadas como referências. Este tipo de seqüenciamento exigirá uma montagem (assembly) das seqüências, utilizando apenas os dados obtidos desse seqüenciamento. Alinhamento entre as seqüencias geradas, que permitirá a obtenção de um consenso.

12 Seqüenciamento em pares – mate-pair – paired-ends (Korbel et al., 2007) > SOLEXA01:1:1:27:1992#0/1 > SOLEXA01:1:1:27:1992#0/2 Referência: ~ 128 bp a ~428 bp paired-ends 36 bp > SOLEXA02:1:1:11:1992#0/1 > SOLEXA02:1:1:11:1992#0/2 Referência: ~ 1928 bp a 4928 bp mate-pair 36 bp

13 Alinhamento de Seqüências Em Bioinformática, alinhamento de seqüências é uma forma de dispor as seqüências de DNA, RNA, ou proteínas para identificar regiões de similaridade que podem ser conseqüência de relacionamentos funcionais, estruturais ou relações evolutivas entre elas.

14 Significado Biológico do Alinhamento de Seqüências Definição de 3 termos importantes: – identidade: refere-se à fração de aminoácidos ou nucleotídeos idênticos entre pares de seqüências após um alinhamento dessas seqüências; – similaridade: refere-se à fração de aminoácidos ou nucleotídeos similares (com propriedades físico- químicas semelhantes – aminoácidos conservados) entre pares de seqüências após um alinhamento dessas seqüências; – homologia: representa uma relação evolutiva entre as seqüências;

15 Identificação das seqüências Reseqüenciamento – Alinhamento: Conjunto de Seqüências X Seqüências Referências (Ex.: Genoma) >seq1 gcagtcagtcacacatgtca... >seq2 cgcgcatgcgcgtactctat... >seq3 tcgagcatcatcagtcgtca... >seq4 tatgctttatagcgagtcat >chrX atcacacatgtcacatggtcag ggcatcagtcagtcagtcatgc gcgcgcatgcgcgtactctatc tcatgcgtcagtcatgcatgcg agcagtcatgcatgcatcgcac tgcatcatacgtcatgcatgaa..... Objetivos: - Eliminar as sequência sem hit - Eliminar as sequência com hits múltiplos (ambiguous) - Guardar as sequência com hit único (unambiguous)

16 Montagem de seqüências Seqüenciamento de novo – Alinhamento: Conjunto de Seqüências X Conjunto de Seqüências ACAGTACGACAGTACGACCAGTACGATAGCAGTACGATACGACCGA TCCAGTACGATAGCAGTACGATCAG GCACAGTACGACCAGTACGATACAGGAAC CAGGTACGATACGACGGACGGGG ACAGTACGACAGTACGAAAC GTACGACCAGTACGATACACT AACGACAGTACGAAACGGG TATAGGTACGATACGACGGAC Consensus : Seq A Seq B Seq C Seq D Seq E Seq F Seq G

17 ALGORITMOS PARA ALINHAMENTO DE SEQÜÊNCIAS Introdução

18 Alinhamentos de Seqüências Alinhamento Global (e.g. Algoritmo de Needleman-Wunsch) As seqüências envolvidas devem ser alinhadas de um extremo ao outro. Adequado quando as seqüências possuem aproximadamente o mesmo tamanho. Seq X : C A T T A G C A G C C T |. | | | | | Seq Y : - A G T A – - A G C - - Alinhamento Local (e.g. Algoritmo de Smith–Waterman) Procura-se alinhar apenas as regiões mais similares, independente da localização relativa de cada região. Seq X [4,10]: T A G C A G C | | | | | Seq Y [3,7]: T A - - A G C Alinhamentos (Global/Local) (DNA/Protein) FASTA (http://fasta.bioch.virginia.edu/fasta_www2/fasta_list2.shtml)http://fasta.bioch.virginia.edu/fasta_www2/fasta_list2.shtml EMBOSS Align (http://www.ebi.ac.uk/Tools/emboss/align/)http://www.ebi.ac.uk/Tools/emboss/align/

19 Problema Transformar uma seqüência de caracteres em outra: – Operações: inserção deleção substituição – Custo de operação: Score de substituição Penalidade para Gaps (inserção/deleção) – Qual é a quantidade de operações mínima ? – Como achar a séries de operações que vai garantir que usamos a quantidade de operações mínima ? Exemplo: ACGT || G-GT Scores: Match: 2 Mismatch (S): -1 Gap(I): -2 Gap(D): -2 Score (4-2-1): 1 2 matches: 4 1 gap: -2 1 mismatch: -1

20 Soluções Método força bruta (busca exaustiva) – Praticamente inviável Algoritmos de Programação Dinâmica – Smith-Waterman; Needleman-Wunsch; SW é um algoritmo para achar o alinhamento mais provável com uma estrutura certa; Por razões de tempo e espaço, não pode ser usado para alinhamento de sequências de larga escala; Utilizações de aproximações (heurísticas); Geralmente, quanto mais rápida for a aproximação, mais distante estará a resposta da solução correta;

21 Matriz de Programação Dinâmica Exemplo: ACGT || G-GT Scores: Match: 2 Mismatch (S): -1 Gap(I): -2 Gap(D): -2 Score (4-2-1): 1 2 matches: 4 1 gap: -2 1 mismatch: -1 D(i, j) = max D(i-1, j-1) + s(xi, yj) (diagonal -> match/mismatch) D(i -1, j) + g (acima -> gap acima) D(i, j -1) + g (esquerda -> gap esquerda) D(i-1,j-1)D(i-1,j) D(i,j-1)D(i,j) traceback GG A > Score (-2-1): -3 1 gap: -2 1 mismatch: -1 > Score(-1-2): -3 1 mismatch: -1 1 gap: -2 > Score(-4-2): -6 2 gaps: -4 1 gap: -2 GG A GG A

22 BLAST Basic Local Alignment Search Tool Heurística: dicionário de palavras E-value (S): número de diferentes alinhamentos com scores equivalentes ou melhores que S que são esperados ocorrer ao acaso em buscas em um banco de dados aleatório, do mesmo tamanho, com a mesma composição de bases; QUANTO MENOR... MELHOR!!! NÃO CONFUNDIR COM P-value (probabilidade)

23 BLAT BLATThe BLAST-Like Alignment Tool Estruturalmente diferente (BLAST) – Além de outros pontos, o Blat constrói um índice do banco de dado de seqüências (database) (k-mers) e faz as buscas na seqüência a qual se deseja consultar (query); Blat é mais rápido, porém menos sensível; Possui código especialmente para lidar com intros em alinhamentos RNA/DNA; Comumente utilizado para localizar uma determinada seqüência no genoma ou determinar a estrutura de exons de um RNA; Pode ser utilizado para alinhar seqüências de Roche/454;

24 Alinhamento de seqüências curtas BLAST/BLAT são lentos demais para alinhar milhões de sequências (Illumina: 35bp- 100bp/SOLiD: ) Premissas: – Não precisamos de um alinhamento sofisticado como SW; – Não precisamos de estatísticas com e-value; – Normalmente, sabemos a quantidade de mismatches máximas que queremos;

25 Alinhamentos baseados em Hashing table Idéia dos algoritmos de alinhamentos baseados em hashing tables: genoma: acggcacgaggaactcgaatctgacgcatgcagtacta | ||| || read: agtcgtat Se admitirmos 2 mismatches entre a minha sequência e o genoma. Se separados em 4 fragmentos, vão existir pelo menos 2 fragmentos sem mismatches !

26 seeds 6 possibilidades de seeds, com no mínimo 2 fragmentos de match perfeito read: agtcgtat --tc--at --tcgt-- ag--gt-- ag----at ----gtat agtc

27 Busca nas tabelas hash São construídas 6 listas das palavras achadas nas leituras; Para cada 6 possibilidades de palavra no genoma, procurar na lista determinada para ver se existe uma possibilidade de matching; Como buscar sequências das palavras nas listas de palavras? Algoritmo de hashing Possui uma função capaz de transformar uma cadeia de caracteres (string) em valores (índices);

28 Alinhamento de Seqüências com hashing Softwares – ELAND (Anthony. J. Cox, 2006, unpublished data), – MAQ (Li H et al., 2008) – SOAP (Li R et al., 2008) Características: – Para detectar mais mismatch, precisamos de mais seeds: Mais mismatch => mais tempo – Algoritmo mais sofisticado para o alinhamento vai requerer mais tempo: Indels/gaps => mais tempo Problemas com hashing: – Memória e tempo Precisa de CPUs múltiplos com muita memória. – Necessidade de métodos menos glutões

29 Burrows–Wheeler Algoritmo usado normalmente em softwares de compressão (.bzip2) Em alinhadores de seqüências: – Bowtie (Langmead B et al., 2009) – BWA BWA-SHORT (Li H. and Durbin R., 2009) BWA-SW (Li H. and Durbin R., 2010) Transformation T => BWT(T) Input All Rotations Sort the Rows @^BANANA Inverse Transformation BWT(T) => T Input Add 1Sort 1Add 2Sort 2 BA NA ^B AN BA NA Add 3Sort 3Add 4Sort 4 BAN NAN ^BA ANA BAN NAN BANA NANA ^BAN ANAN BANA NANA Add 5Sort 5Add 6Sort 6 BANAN ^BANA ANANA BANAN BANANA ^BANAN @^BANA BANANA Add 7Sort 7Add 8Sort 8 ^BANANA @^BANAN @^BANANA @^BANANA Output

30 Bowtie – Burrows-Wheeler; Reduz a quantidade de memória e de tempo para alinhar sequências curtas; Podem ser usadas seqüências Illumina e SOLiD – Deficiências: Não tem garantia de retornar todos os hits com mismatches (exceto com opção --best) Limite de 3 mismatches (demora mais) Reads longos reduz a velocidade Não tem indels

31 LF mapping

32 Inexact Matching

33 BOWTIE Introdução

34 Bowtie Index Builder: bowtie-build Usage: bowtie-build [options]* reference_in comma-separated list of files with ref sequences ebwt_outfile_base write Ebwt data to files with this dir/basename Options: -f reference files are Fasta (default) -c reference sequences given on cmd line (as ) -C/--color build a colorspace index -a/--noauto disable automatic -p/--bmax/--dcv memory-fitting -p/--packed use packed strings internally; slower, uses less mem -B build both letter- and colorspace indexes --bmax max bucket sz for blockwise suffix-array builder --bmaxdivn max bucket sz as divisor of ref len (default: 4) --dcv diff-cover period for blockwise (default: 1024) --nodc disable diff-cover (algorithm becomes quadratic) -r/--noref don't build.3/.4.ebwt (packed reference) portion -3/--justref just build.3/.4.ebwt (packed reference) portion -o/--offrate SA is sampled every 2^offRate BWT chars (default: 5) -t/--ftabchars # of chars consumed in initial lookup (default: 10) --ntoa convert Ns in reference to As --seed seed for random number generator -q/--quiet verbose output (for debugging) -h/--help print detailed description of tool and its options --usage print this usage message --version print version information and quit [/data/indexes]$ bowtie-build /data/hg18.fa hg18 $BOWTIE_INDEXES=/data/indexes hg18.1.ebwt hg18.2.ebwt hg18.3.ebwt hg18.4.ebwt hg18.rev.1.ebwt hg18.rev.2.ebwt

35 Bowtie Index Inspector: bowtie-inspect Usage: bowtie-inspect [options]* ebwt filename minus trailing.1.ebwt/.2.ebwt By default, prints FASTA records of the indexed nucleotide sequences to standard out. With -n, just prints names. With -s, just prints a summary of the index parameters and sequences. With -e, preserves colors if applicable. Options: -a/--across Number of characters across in FASTA output (default: 60) -n/--names Print reference sequence names only -s/--summary Print summary incl. ref names, lengths, index properties -e/--ebwt-ref Reconstruct reference from ebwt (slow, preserves colors) -v/--verbose Verbose output (for debugging) -h/--help print detailed description of tool and its options --help print this usage message [/data/indexes]$ bowtie-inspect -s hg18

36 Bowtie Aligner: bowtie Reporting: -k report up to good alignments per read (default: 1) -a/--all report all alignments per read (much slower than low -k) -m suppress all alignments if > exist (def: no limit) -M like -m, but reports 1 random hit (MAPQ=0); requires --best --best hits guaranteed best stratum; ties broken by quality --strata hits in sub-optimal strata aren't reported (requires --best) Output: -t/--time print wall-clock time taken by search phases -B/--offbase leftmost ref offset = in bowtie output (default: 0) --quiet print nothing but the alignments --refout write alignments to files refXXXXX.map, 1 map per reference --refidx refer to ref. seqs by 0-based index rather than name --al write aligned reads/pairs to file(s) --un write unaligned reads/pairs to file(s) --max write reads/pairs over -m limit to file(s) --suppress suppresses given columns (comma-delim'ed) in default output --fullref write entire ref name (default: only up to 1st space) Colorspace: --snpphred Phred penalty for SNP when decoding colorspace (def: 30) or --snpfrac approx. fraction of SNP bases (e.g ); sets --snpphred --col-cseq print aligned colorspace seqs as colors, not decoded bases --col-cqual print original colorspace quals, not decoded quals --col-keepends keep nucleotides at extreme ends of decoded alignment SAM: -S/--sam write hits in SAM format --mapq default mapping quality (MAPQ) to print for SAM alignments --sam-nohead supppress header lines (starting for SAM output --sam-nosq header lines for SAM output --sam-RG add (usually "lab=value") line of SAM header Performance: -o/--offrate override offrate of index; must be >= index's offrate -p/--threads number of alignment threads to launch (default: 1) --mm use memory-mapped I/O for index; many 'bowtie's can share --shmem use shared mem for index; many 'bowtie's can share Other: --seed seed for random number generator --verbose verbose output (for debugging) --version print version information and quit -h/--help print this usage message Usage: bowtie [options]* {-1 -2 | --12 | } [ ] Comma-separated list of files containing upstream mates (or the sequences themselves, if -c is set) paired with mates in Comma-separated list of files containing downstream mates (or the sequences themselves if -c is set) paired with mates in Comma-separated list of files containing Crossbow-style reads. Can be a mixture of paired and unpaired. Specify "-" for stdin. Comma-separated list of files containing unpaired reads, or the sequences themselves, if -c is set. Specify "-" for stdin. File to write hits to (default: stdout) Input: -q query input files are FASTQ.fq/.fastq (default) -f query input files are (multi-)FASTA.fa/.mfa -r query input files are raw one-sequence-per-line -c query sequences given on cmd line (as, ) -C reads and index are in colorspace -Q/--quals QV file(s) corresponding to CSFASTA inputs; use with -f -C --Q1/--Q2 same as -Q, but for mate files 1 and 2 respectively -s/--skip skip the first reads/pairs in the input -u/--qupto stop after first reads/pairs (excl. skipped reads) -5/--trim5 trim bases from 5' (left) end of reads -3/--trim3 trim bases from 3' (right) end of reads --phred33-quals input quals are Phred+33 (default) --phred64-quals input quals are Phred+64 (same as --solexa1.3-quals) --solexa-quals input quals are from GA Pipeline ver. = integer-quals qualities are given as space-separated integers (not ASCII) Alignment: -v report end-to-end hits w/ max mismatches in seed (can be 0-3, default: -n 2) -e/--maqerr max sum of mismatch quals across alignment for -n (def: 70) -l/--seedlen seed length for -n (default: 28) --nomaqround disable Maq-like quality rounding for -n (nearest 10 minimum insert size for paired-end alignment (default: 0) -X/--maxins maximum insert size for paired-end alignment (default: 250) --fr/--rf/--ff -1, -2 mates align fw/rev, rev/fw, fw/fw (default: --fr) --nofw/--norc do not align to forward/reverse-complement reference strand --maxbts max # backtracks for -n 2/3 (default: 125, 800 for --best) --pairtries max # attempts to find mate for anchor hit (default: 100) -y/--tryhard try hard to find valid alignments, at the expense of speed --chunkmbs max megabytes of RAM for best-first search frames (def: 64) [/data]$ bowtie hg18 > -c "AGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTT,AGGGCCCATAGCAACAGATTTCTAGCCCCCTGAAGA" > --best --strata --tryhard -m 1

37 CONSIDERAÇÕES FINAIS Conclusão

38 Alinhamento global: Alinhamento de 2 sequências com mesmo tamanho: – Algoritmo de Needleman-Wunsch Alinhamento local: Alinhamento de 2 seqüências, uma curta e a outra muito mas longa: – Algoritmo de Smith-Waterman Encontram o alinhamento mais provável; Lentos para alinhamentos contra o genoma inteiro; Baseados em um modelo matemático, os outros, são baseados em heurísticas, sem prova formal de obtenção da solução ótima;

39 Conclusão BLAST: Utiliza heurísticas (k-tuples); – Maior sensibilidade; – Possui estatísticas, o E-value além do Score; – Pode ser usado para Sanger (megablast), mas é muito lento com seqüências Roche/454; BLAT: Utiliza heurísticas (semelhante ao BLAST - índice do banco de dados na memória) – Blat é mais rápido, porém menos sensível; – Lida melhor com intros em alinhamentos RNA/DNA, bom para determinar estrutura de exons de RNAs; – Pode ser utilizado para alinhar seqüências de Roche/454;

40 Conclusão Next-Generation Sequence Alignments – Primeiros programas: Hashing Illumina e SOLiD; – ELAND (Anthony. J. Cox, 2006, unpublished data), – MAQ (Li H et al., 2008) – SOAP (Li R et al., 2008) Requerem muita memória; O nível de sensibilidade depende do programa e das opções; – A partir de 2009: Burrows-Wheeler Illumina e SOLiD; – Bowtie (Langmead B et al., 2009) – BWA (Li H. and Durbin R., 2009) Requerem menos memória e são mais rápidos;

41 Conclusão Novas plataformas de seqüenciamento irão surgir exigindo novos programas de alinhamento; Não há um programa perfeito para todas as situações; É importante entender como os programas funcionam e como a configuração pode influenciar os resultados; – Heurística utilizada; – Argumentos; sensibilidade rapidez (tempo/memória)

42 Visualização IGV (Genome Browser) – – Formatos de arquivos: BAM, BED, Birdsuite Files, CBS, CN, Cytoband, FASTA, GCT, genePred, GFF, GISTIC, HDF5, IGV, LOH, MAF, PSL, MUT, RES, SAM, Sample Information, SEG, SNP, TAB, TDF, Track Line, Type Line, WIG

43 Daniel Guariz Pinheiro

44 EXERCÍCIO Fim

45 Bowtie – cvbioinfo2011_p1.fa – cvbioinfo2011_p2.fa


Carregar ppt "Alinhamento de Seqüências Genéticas Daniel Guariz Pinheiro, PhD. Laboratório de Genética Molecular e Bioinformática Departamento de Genética Faculdade."

Apresentações semelhantes


Anúncios Google