A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Seqüenciamento parcial de transcritos. Objetivo: Documentar a existência de transcritos gênicos num transcriptoma [otorrin... e...damonh...] EST (Etiqueta.

Apresentações semelhantes


Apresentação em tema: "Seqüenciamento parcial de transcritos. Objetivo: Documentar a existência de transcritos gênicos num transcriptoma [otorrin... e...damonh...] EST (Etiqueta."— Transcrição da apresentação:

1 Seqüenciamento parcial de transcritos

2 Objetivo: Documentar a existência de transcritos gênicos num transcriptoma [otorrin... e...damonh...] EST (Etiqueta de Seqüência Expressa) –sequenciamento único de cada cDNA –extremidades 5 ou 3 ORESTES (ESTs ricas em ORFs) –seqüenciamento único do amplicon derivado de cDNA por PCR inespecífico –centro do cDNA prevalece (região conservada)

3 Um mRNA & suas ESTs (A) 20 0 (T) 18 cDNA (fita -) AUG (A) 18 cDNA (fita +) (A) 20 0 (T) 18 cDNA (fita -) AUG (A) 18 cDNA (fita +) ATG ATCATGACTTACGGGCGCGCGAT GGCGCGCGATATCC A A A T T T A T T A T C C 3EST 5EST A A A T T T A T T A T C C A T C T A C G

4 PCR inespecífico & seu ORESTES (A) 200 cDNA (fita -) AUG amplicon (fita +) Iniciador (60ºC 37ºC) amplicon (fita -) amplicon (fita +) PCR (60ºC) ORESTES AGATCGATCATGACTTACGGGCGCGCGATATCG GGGCGCGCGATATCGAAAAATTTATAAGGCTAG CCCCGGCGGCTCGGCCGGGGAGATCGATCATGAC +ORESTES (outros iniciadores)

5 Qualidade das bibliotecas (100 primeiras ESTs) Número de vezes que uma EST foi amostrada Boa biblioteca?

6 Uma das atividades da bioinformática é formar aglomerados (clusters) de todas as sequências que foram geradas no projeto Além de validar bibliotecas Podemos saber quantas vezes um gene foi sequenciado e detectar os mais freqüentes E quantos genes já foram detectados Aglomerados

7 Programas para aglomerar Icatools Phrap Cap3 Swat BLAST MegaBLAST Um aglomerado = Um gene

8 É um sistema que parte as sequências do GenBank em um conjunto não-redundante de aglomerados Cada aglomerado do UniGene contém as sequências que representam um gene único E também informações relacionadas, como em que tecidos o gene é expresso E onde foi mapeado MegaBLAST #megablast -W 40 -F m -D 3... UniGene

9 MegaBLAST gera o UniGene Todas ESTs contra todas Detecção de homologia > 96% de identidade > 70% do potencial Aglomerar

10 Anotação funcional convencional Hardware 4 GB RAM Multiprocessado 2 MB cache HD com alta capacidade (bancos de dados) Solaris Intel

11 Alinhamento local Identifica, numa coleção de seqüências, as que apresentam alinhamento com cada EST. O algorítimo vai utilizar fragmentos da EST e alinhar com as sequências do banco de dados. Ele vai descartando todas as pesquisas com pontuação pequena (score baixo) e vai alinhar a vizinhança daquelas com pontuação boa até chegar ao máximo valor. É fácil verificar que algumas regiões de certos genes alinham bem mas outras, pouco conservadas, não. O Alinhador Local não quer chegar ao alinhamento final, ele só quer identificar sequências com alguma coisa (de tamanho significativo) em comum

12 Alinhamento local O fundamento teórico é que a função gênica está quase sempre confinada em domínios contínuos de uma proteína Já ouviram falar que exons representam domínios funcionais distintos, que teriam evoluído de genes ancestrais individuais? Se não fosse assim, não teria sentido usar

13 Programas Blast & Bancos Há vários Programas Blast úteis Alguns são usados quando a sua sequência é de nucleotídeos (blastn, blastx e tblastx) Outros são usados quando a sua sequência é de aminoácidos (blastp e tblastn) E vários bancos de dados para escolher (nr, pdb, dbEST, yeast, month, etc...) Ou usa-se limites

14 Blastn e Blastx A EST identifica o gene homólogo ou uma EST de outro organismo: Blastn A EST identifica proteína ortóloga de outro organismo - a evolução conservou a proteína enquanto o DNA divergiu: Blastx –Blastx: a EST traduzida em seis proteínas –1 existe, 5 não... –O mundo Blast é assim

15 Tblastx Tblastx traduz sua sequência de nucleotídeos para proteína nas 6 possibilidades, exatamente como Blastx Depois pesquisa com essas 6 proteínas deduzidas, um banco de dados de nucleotídeos também traduzido dessa maneira Pra que serve? Pois imagine que a telomerase de Euplotes seja parecida com a telomerase humana, mas os dois DNA não! Traduzindo a sequência pesquisada e o banco de dados dbEST foi possível encontrar sequências da telomerase humana

16 Bioinformática e anotação reversa Genes pré-escolhidos –Categorias funcionais –Proteínas TBLASTn –sua proteína contra as ESTs traduzidas em seis fases de leitura

17 O formato FASTA é anotado >Gene5 EST com homologia... ACTATTACGGCGTAGCTGTAGCTACGTAGCTAGCT GATGCTGACTGATCGTAGCTAGCTGACTGATCGTA CGTAGTGTTTTTTTACGTGCGTATTTCTagctagtc

18 Processamento de seqüências cgtaAGCTGATCTaCGTGTgCGCGTATCGGTCAGCacgATGTTGTTa PHRED - basecall and quality values PHRAP - consenso com qualidade CROSSMATCH - retira vetor TGTgCGCGTATCGGTCAGCacgATGTT

19 Programas UNIX (Solaris Intel, Tru64, Linux) MegaBLAST –Validação de Bibliotecas –UniGene: um aglomerado - um gene - um spot Anotação funcional –BLASTn, BLASTx, tBLASTx (dbEST) –Base de dados nr e dbEST Anotação reversa (seq. completo?) –tBLASTn e base de dados de mineradora genômica Processamento de seqüências –PHRED, CROSS-MATCH, PHRAP Servidor BLAST na Web

20 Ambiente Baseado em estrutura do CENAPAD Replicação de bases de dados em servidores Ambiente colaborativo Automatização de serviços –Diablos, agentes computacionais Bancos de dados Oracle/Domino


Carregar ppt "Seqüenciamento parcial de transcritos. Objetivo: Documentar a existência de transcritos gênicos num transcriptoma [otorrin... e...damonh...] EST (Etiqueta."

Apresentações semelhantes


Anúncios Google