A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Aplicações de Bioinformática (Epigenética) Daniel Guariz Pinheiro.

Apresentações semelhantes


Apresentação em tema: "Aplicações de Bioinformática (Epigenética) Daniel Guariz Pinheiro."— Transcrição da apresentação:

1 Aplicações de Bioinformática (Epigenética) Daniel Guariz Pinheiro

2 Tópicos Abordagens Análise após sequenciamento com bissulfito Comparação de Genomas Análise de Expressão Gênica Diferencial Alelo Específica Análise de Perfis de Metilação e Predição de Classes Banco de Dados MethDB

3 Análise após o sequenciamento com bissulfito Tratamento com bissulfito - Conversão de Citosinas não metiladas para Uracila. Análise dos dados : Manual x Automatizada Ferramentas Computacionais : MethTools BIQ Analyzer Alinhamento Global : ClustalW CGCCGCTGCCGCTCGGTGGCCGGGCCGGG CG CCTCCACCCCCCTCGCAGTCATGTGCCTG TGTTGTTGTTGTTTGGTGGTTGGGTTGGG CG TTTTTATTTTTTTTGTAGTTATGTGTTTG

4 MethTools Coleção de ferramentas computacionais específicas para o processo de comparação que geram saídas gráficas que permitem: Identificar padrões de metilação Analisar a densidade dos padrões de metilação Identificar possíveis motivos para metilação Estimar os erros sistemáticos do experimento

5 Padrões de Metilação Lollipops

6 Densidade dos Padrões de Metilação Gráfico de Densidade

7 Motivos para Metilação Logos – O consenso geral das seqüências – A ordem de predominância de um resíduo em cada posição – A freqüência relativa de cada um dos resíduos em cada posição – A quantidade de informação em cada uma das posições na seqüência – Localização significante

8 Estimativa de erros sistemáticos do experimento Estimativa feita a partir do número de trocas de bases diferentes das de C para T.

9 BIQ Analyzer Programa interativo que automatiza o processo de análise de metilação por seqüênciamento com bissulfito. O BIQ Analyzer pode auxiliar nos seguintes processos: Importação dos dados do sequenciador Alinhamento das seqüências Identificação de seqüências críticas Gera estatísticas básicas Produz diagramas úteis

10 Diagrama (BIQ Analyzer)

11 Controle de Qualidade (BIQ Analyzer) Tipos de erros freqüentes e soluções: Conversão incompleta No caso de vertebrados é utilizado o critério da taxa de conversão. Seqüências clones É utilizado um método heurístico para detecção de clones. Erros no sequenciamento Sugere a exclusão das seqüências com baixa identidade.

12 Comparação de Genomas Domínios de Imprinting - - Região 11p15 (Hs) - Cromossomo 7 (Mm) Regiões Conservadas (não exônicas) % Regiões ricas em GC ou - Ilhas CpG. Genes Metilados - Associados a ilhas CpG (2 ou mais) Certos padrões de regulação gênica e dos elementos regulatórios correspondentes estão freqüentemente conservados entre as espécies. Envolve o alinhamento de regiões genômicas ortólogas. Onyango, P. et al. (2000)

13 PipMaker PIP (Percent Identity Plot ) - gráfico com a porcentagem de identidade entre as regiões ao longo das seqüências. Alinhamento Local - BLASTZ Identificação de Repeats - RepeatMasker Predição Gênica - Genscan Mapeamento de Transcritos - Matches com ESTs Mapeamento de Ilhas CpG - Gardiner-Garden e Frommer Schwartz et al. (2000)

14 Análise de Expressão Gênica Diferencial Alelo Específica UniGene – ESTs (Expressed Sequence Tags) SNPs (Single Nucleotide Polymorphisms) Biblioteca de EST Indivíduo EST Library Only allele A was found Alleles A and B were found Only allele B was found Individual genotyping Population allele freq Z-statistics Bayes inference AA or ABABBB or AB Q A = P AA + 0.5P AB ; Q B = 1-Q A ; Q AB = 2Q A Q B Cálculo da diferença entre P AB e Q AB P AB tende a ser menor que Q AB para gene metilados Estimados P AA, P AB e P BB para a população

15 Expressão Gênica Diferencial Alelo Específica SNPs 194 mais significantes 4 genes conhecidos com imprinting

16 Análise de Perfis de Metilação e Predição de Classes Objetivo Extrair informação dos dados e identificar sua implicação biológica em determinado fenótipo. Auxiliar no diagnóstico e/ou prognóstico de uma doença (AML e ALL). Estratégia Baseada em certos padrões de metilação do DNA que estão correlacionados com determinados parâmetros fenotípicos. Utilizar uma análise baseada em microarrays. Utilizar sistemas de Aprendizado de Máquina SVM (Support Vector Machine)

17 Análise de Metilação Baseada em MicroarraysCG CG m BissulfitoUG CG m PCRTGCG Sondas (oligonucleotídeos)ACGC

18 ALL x AML AML – Leucemia Mielóide Aguda – 17 amostras (tecidos e linhagem celulares) ALL – Leucemia Linfoblástica Aguda – 8 amostras (tecidos e linhagens celulares) 81 sítios CpG (região promotora, exons ou introns) Genes : ELK1, CSNK2B, 1-myc, CD63, CDC25A, TUBB2, CD1A, CDK4, n- myc, AR e c-MOS Vetor de atributos para cada amostra: – Razão : log CG/TG para os 81 sítios 20 Sítios CpG para os genes ELK1 e AR (cromossomo X)

19 Sistema de Aprendizado de Máquina Supervisionado Vetor de atributos X = {x i : x i є R n }, i = 1,...,n Número de atributos n = 81 Vetor de classes Y = {y j : y j є {ALL,AML}}, j = 1,...,m Número de exemplos que serão treinados m Conjunto de treinamento {X, Y} Performance de Generalização Estimada a partir da quantidade de erros de classificação na fase de testes

20 Support Vector Machine Objetivo: encontrar uma função discriminante (f) capaz de capturar as propriedades essenciais da distribuição dos dados e evitar o super ajustamento aos dados de treinamento. SVM - discriminante linear ( f : R n {ALL,AML}) – separar os dados do conjunto de treinamento – maximizar a distância da margem do hiperplano

21 Redução de Dimensionalidade Critérios avaliados – Fisher – Golub – t-test – PCA – Backward Elimination Método Avaliação – Cross-validation (repetido 50 vezes) 8 Partições – 7 treinamento – 1 teste

22 SVM (ALL / AML) Critério de Fisher – CSNK2B CpG2 (eixo-x) – CDK4 CpG3 (eixo-y)

23 Banco de Dados (MethDB) MethDB (setembro, 2002) 6667 experimentos 46 espécies, 160 tecidos e 72 fenótipos Tipos de dados Descrições dos experimentos Padrões e perfis de metilação Padrão de metilação : seqüência 5 mucleotídeos (incluindo a 5mC) Perfil de metilação : representação da metilação ao longo das seqüências (lollipops) Conteúdo de metilação total Quantidade de 5mC em uma amostra de DNA.


Carregar ppt "Aplicações de Bioinformática (Epigenética) Daniel Guariz Pinheiro."

Apresentações semelhantes


Anúncios Google