A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Uso da bioinformática na análise genômica. Início Fim Receber Processar Anotar Depositar Bioinformática.

Apresentações semelhantes


Apresentação em tema: "Uso da bioinformática na análise genômica. Início Fim Receber Processar Anotar Depositar Bioinformática."— Transcrição da apresentação:

1 Uso da bioinformática na análise genômica

2 Início Fim Receber Processar Anotar Depositar Bioinformática

3 A nomeação é praticamente aleatória no início e no final, onde a chance de erro é alta (baixo valor de Phred) O programa Phred lê o cromatograma e nomeia as bases cromatograma acgatctcgctagctgctactgtagccgcgattattcgcgatctacgtatatcgcgatcgatc Cada base tem uma chance de erro de sua nomeação (10% = 0,1) A escala de Phred é semelhante à de pH multiplicado por 10: - chance de erro de 0,001 = = Phred 30 Processamento de seqüências DNA: FASTA Seq.qual

4 Seqüências Ano milhões Crescimento do GenBank EuropeuJaponês 24h

5 Seqüencias do DNA (genoma) Seqüências do mRNA (genes expressos) Repetição calculada draft = 5x finished = 10x Amostragem tecidos momentos Genoma pequeno (seqüenciador grande) Eucariotos mRNA cDNA TR

6 Seqüenciamento parcial de transcritos

7 Seqüênciamento de genes expressos: Documentar a existência de transcritos gênicos num transcriptoma [otorrin... e...damonh...] EST (Etiqueta de Seqüência Expressa) –seqüenciamento único de cada cDNA –extremidades 5 ou 3 ORESTES (ESTs ricas em ORFs) –seqüenciamento único do amplicon derivado de cDNA por PCR inespecífico –prevalece o centro do cDNA (cds)

8 Um mRNA & suas ESTs (A) 20 0 (T) 18 cDNA (fita -) AUG (A) 18 cDNA (fita +) (A) 20 0 (T) 18 cDNA (fita -) AUG (A) 18 cDNA (fita +) ATG ATCATGACTTACGGGCGCGCGAT GGCGCGCGATATCC A A A T T T A T T A T C C 3EST 5EST A A A T T T A T T A T C C A T C T A C G Quantas ESTs de Schistosoma mansoni há no NCBI? Quantas proteínas não mitocondriais?

9 PCR inespecífico & seu ORESTES (A) 200 cDNA (fita -) AUG amplicon (fita +) Iniciador (60ºC 37ºC) amplicon (fita -) amplicon (fita +) PCR (60ºC) ORESTES AGATCGATCATGACTTACGGGCGCGCGATATCG GGGCGCGCGATATCGAAAAATTTATAAGGCTAG CCCCGGCGGCTCGGCCGGGGAGATCGATCATGAC +ORESTES (outros iniciadores) Quantos ORESTES estão hoje no NCBI? Eles são ESTs? Só há ORESTES humanos?

10

11 2. Estudando coleções de sequências Alinhamento de um grupo pequeno de sequências com MultiAlignMultiAlign Descarregando um grande número de sequências através do BatchEntrezEntrez Formação de aglomerados de sequências com Icatools, com Cap3 ou Megablast IcatoolsCap3Megablast Estimando distância evolutiva com PhylipPhylip

12 Uma das atividades em bioinformática é formar aglomerados de todas as sequências geradas no projeto (as figurinhas de um álbum) Podemos saber quantas vezes um gene foi seqüenciado, e detectar os freqüentes! E quantos dos genes foram detectados –Usa-se também para validar bibliotecas –Pode usar dados originais ou descarregados do NCBI Aglomerados ou Clusters

13 Alinhamento global: usar para publicar Quando se quer comparar globalmente as sequências, busca-se o melhor alinhamento global Um bom algoritmo computacional é o usado no Fast Alignment, apelidado de FASTA

14 Inicialmente busque suas seqüências Descarregue uma lista dos indicadores delas (GI) Use o BatchEntrez para baixar o FASTA das seqüências Estude-as localmente com seu programa predileto Descarregando muitas seqüências com BatchEntrez

15 Comparação exaustiva Visando Use o BatchEntrez para baixar o FASTA das seqüências Estude-as localmente com seu programa predileto Alinhamento Global

16 Genes ortólogos são os homólogos mais próximos entre dois organismos (BestHit) A evolução os faz diferentes Phylip DNAdist mede Phylip Protdist para proteínas Plylip Neighbor faz uma matriz E um desenhador de árvore: Phylip

17 Programas para aglomerar Icatools Phrap Cap3, Cap4 Swat BLAST MegaBLAST Um aglomerado = Um gene

18 Organização das sequências do GenBank em um conjunto de aglomerados Cada aglomerado do UniGene contém as sequências que representam um gene único E também informações relacionadas, como em que tecidos o gene é expresso, etc. E também onde está mapeado UniGene

19 MegaBLAST gera o UniGene Todas ESTs contra todas Detecção de homologia > 96% de identidade > 70% do potencial Aglomerar

20 Qualidade das bibliotecas (100 primeiras ESTs) Freqüência em que uma EST foi amostrada Boa biblioteca? Número de seqüências

21 catcgatcgatcgtcgtagctacgtagctagctagctagctagctagctaactagctgactg catcgatcgatcgtcgtagctacgtagctagctagctagctagctagctagctagctgactg catcgatcgatggtcgtagctacgtagctagctagctagctagctagctagctagctgactg catcgatcgatcgtcgtagctacgtagctagctagctagctagctagctagctagctgactg catcgatcgatcgtcgtagctacgtagctatctagctagctagctagctagctagctgactg catcgatcgatcgtcgtagctacgtagctagctagctagctagctagctagctagctgactg catcgattgatcgtcgtagctacgtagctagctagctagctagctagctagctagctgactg catcgatcgatcgtcgtagctacgtagctagctagctagctagctagctagctagctgactg


Carregar ppt "Uso da bioinformática na análise genômica. Início Fim Receber Processar Anotar Depositar Bioinformática."

Apresentações semelhantes


Anúncios Google