A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

DNA FINGER PRINT PROF. ALEXANDRE S. OSÓRIO. GENOMA NUCLEAR.

Apresentações semelhantes


Apresentação em tema: "DNA FINGER PRINT PROF. ALEXANDRE S. OSÓRIO. GENOMA NUCLEAR."— Transcrição da apresentação:

1 DNA FINGER PRINT PROF. ALEXANDRE S. OSÓRIO

2 GENOMA NUCLEAR

3 MICROSSATÉLITES Seqüências hipervariáveis (também chamadas polimórficas) repetitivas de 1 a 4 pb com distribuição ao longo do genoma. O polimorfismo destas seqüências é resultado de diferentes rearranjos envolvendo segmentos de DNA de tamanhos diferentes. Herança Mendeliana (os filhos sempre recebem metade dos alelos de origem materna e metade de origem paterna).

4 MICROSSATÉLITES Exemplos de seqüências de microssatélites: Repetição de 1 base: GTAAAAAAAAAAAAAAAGGAT Repetição de 2 bases: GTCACACACACACACACAGGAT (dinucleotídeo) Repetição de 3 bases: GTCACCACCACCACCACCACGGAT (trinucleotídeo) Repetição de 4 bases: GTCAGACAGACAGACAGAGGAT (tetranucleotídeo) - Polimorfismos são devidos às diferenças no número de repetições - São também conhecidos como short tandem repeat (STR). - O número de repetições em seqüência pode variar, sendo chamadas de VNTRs (Variable Number of Tandem Repeats = número variável de repetições em seqüência).

5 IMPRESSÕES DIGITAIS DO DNA (DNA FINGERPRINTS) O QUE SIGNIFICA? Com base no estudo de uma bateria de microssatélites, é possível obter perfis genéticos praticamente indivíduo-específicos, muito úteis na investigação de paternidade, identificação de vítimas e criminosos. TÉCNICAS RFLP (Restriction Fragment Lenght Polymorphism). PCR (Polymerase Chain Reaction).

6 Polimorfismo de Comprimento de Fragmento de Restrição 1) Coleta de amostras biológicas que podem ser saliva, sangue, esperma e cabelo com raiz, entre outros. 2) Extração e purificação do DNA. 3) Corte com enzimas de restrição (tesouras moleculares que reconhecem e cortam seqüências específicas do DNA). 4) Eletroforese: onde, através de uma corrente elétrica, são separados os fragmentos de DNA por tamanho. A partir daí, é formada uma espécie de código de barras que é a identificação individual e intransferível de cada indivíduo.

7 As enzimas de restrição Fazem parte de um sistema da célula bacteriana denominado sistema de modificação-restrição. Este sistema consiste numa endonuclease de restrição. O nome dado a enzima refere-se ao organismo de onde foi isolado. A primeira letra representa o gênero e as outras duas a espécie, seguido de um algarismo romano (ou outra letra) que indica a ordem da descoberta ou a linhagem da qual foi isolado. Sítios de reconhecimento, modificação e clivagem por alguns enzimas de restrição EnzimaLocal de restriçãoOrganismo de origem EcoRI Escherichia coli HindIII Haemophilus influenza Smal Serratia marcescens

8 Enzimas de restrição Uma enzima de restrição ou endonuclease de restrição é um tipo de nuclease que cliva uma cadeia dupla de DNA sempre que identificar uma sequência específica de 4 a 8 pares de bases que seja o local de restrição da enzima (Smith & Wilcox, 1970). As seqüências reconhecidas apresentam nas duas cadeias complementares seqüências idênticas mas invertidas – palíndromo.

9

10 PCR – REAÇÃO EM CADEIA DE POLIMERASE Aquecimento do DNA a ser amplificado a temperatura de 94°C por 1 minuto, o que provoca separação da dupla hélice. Depois, com a temperatura mais baixa, são empregadas as polimerases, que atuam em cada uma das cadeias do DNA, complementando os pares de bases. A cada ciclo, a quantidade de DNA-alvo é duplicada, de modo que em 10 ciclos obtêm-se 1024 vezes mais DNA-alvo; em 20 ciclos, cerca de 1 milhão de vezes mais DNA-alvo. Propicia um aumento na eficiência da análise de material genético Polimerases são enzimas que ocorrem nas células e catalisam reações de polimerização (formação de moléculas de cadeias longas) Pela técnica PCR promove-se a duplicação de trechos do DNA in vitro.

11 PCR

12 VISUALIZAÇÃO DO DNA Uso de sondas: pequenos segmentos de DNA radioativados, cuja seqüência de bases é conhecida. Acoplam-se às seqüências de DNA das quais são complementares, ligando-se às mesmas. SLP: detecta um único segmento de DNA repetitivo em um único cromossomo. Seu uso resulta em um padrão que contém no máximo duas bandas: uma para cada segmento de DNA reconhecido em cada membro do par de cromossomos homólogos. Para a obtenção de padrões mais característicos de cada pessoa, são necessárias várias sondas. Devido à sua sensibilidade, são empregadas nas investigações criminais.

13 SLP (single-locus probe)

14 VISUALIZAÇÃO DO DNA MLP: detecta vários segmentos de DNA repetitivo localizados em muitos cromossomos. O padrão obtido consiste em aproximadamente 20 a 30 bandas. Por isso, a probabilidade de duas pessoas tomadas ao acaso apresentarem todas as bandas exatamente com a mesma posição é extremamente baixa (1:10 trilhões).

15 MLP (multi-locus-probe)

16

17

18

19

20

21

22 RESULTADOS DE TESTES Mary Higgins foi violentada no Central Park em Nova York. Três suspeitos foram presos. O DNA revelou o verdadeiro agressor.

23 RESULTADOS DE TESTES O assassinato de Jon Bennet Ramsey: um crime sem solução? Tristeza ou remorso ?

24 RESULTADOS DE TESTES Em 1987: casal de noivos – Matthew Brock e Kelly Lynn Perry (também estuprada) – é achado baleado na cabeça (bala de rifle calibre 30) em Rodman Dam, área de recreação na Flórida. Principais suspeitos: os adolescentes Randall Scott Jones e Chris Reesh.

25


Carregar ppt "DNA FINGER PRINT PROF. ALEXANDRE S. OSÓRIO. GENOMA NUCLEAR."

Apresentações semelhantes


Anúncios Google