A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Introdução à análise por marcadores moleculares Prof. Vinicius Campos Disciplina de Biotecnologia Animal Graduação em Biotecnologia UFPel.

Apresentações semelhantes


Apresentação em tema: "Introdução à análise por marcadores moleculares Prof. Vinicius Campos Disciplina de Biotecnologia Animal Graduação em Biotecnologia UFPel."— Transcrição da apresentação:

1 Introdução à análise por marcadores moleculares Prof. Vinicius Campos Disciplina de Biotecnologia Animal Graduação em Biotecnologia UFPel

2 Genética 1900s - Descoberta dos princípios genéticos Melhoramento genético científico genética quantitativa e biometria (fenótipo é previsor ruim do valor genético!) Utilização de marcadores genéticos molecularesA

3 Sucesso no melhoramento depende da capacidade de distinguir fatores genéticos herdáveis dos ambientais Marcadores genéticos são unidades herdáveis simples marcadores cromossoma

4 Polimorfismo de DNA resulta acúmulo de mutações pontual ou inserção/deleção macro-rearranjos: translocações, inversões, deleções

5 1.Mutações pontuais – SNPs A.ATCTCGTGATTCCTAGTCGTA TAGAGCACTAAGGGATCAGCAT ex. Sítio EcoRI B.ATCTCGTGATTATAGTCGTA TAGAGCACTAATATCAGCAT 2. Pequenas deleções e/ou inserções - InDels A.ATCTCGTCTAGTCGTA TAGAGCAGATCAGCAT B.ATCTCGT---GTCGTA TAGAGCA---CAGCAT Origem do Polimorfismo Molecular

6 Principais Marcadores na Indústria Animal Polimorfismos Tipo RFPL Polimorfismos Tipo RAPD Marcadores Microssatélites Classes de Marcadores

7 Restriction Fragment Length Polymorphism - RFLP Polimorfismo de tamanho de fragmento RFLP examina diferença em tamanho de fragmentos de restrição de DNA específicos Polimorfismo deriva de mutação pontual, inserção, deleção Utiliza-se DNA celular total Requer DNA puro de alto peso molecular

8 Como funciona

9 Herança

10 Extração de DNA A amostra de DNA é amplificada por PCR Digestão enzimática dos produtos de PCR com enzima de restrição adequada e à sua temperatura ótima Utilizam-se controles normais e se disponíveis controlos homozigóticos e heterozigóticos para a mutação Os produtos da digestão são colocados nos poços de um gel de agarose ou de poliacrilamida RFLP - Procedimento

11 RFLP - Análise

12 RFLP Eletroforese da digestão enzimática com MscI e FauI para pesquisa da mutação L858R

13 RFLP Eletroforese da digestão enzimática com Bcl I para pesquisa da mutação H63D

14 Random Amplification of Polymorphic DNA - RAPD Amplifica seqüências anônimas de DNA usando primers arbitrários 10 bases com >50% G+C PCR com um único primer Método rápido para detecção de polimorfismos Marcador dominante Problemas de reproducibilidade

15 RAPD AA Aa aa AA Aaaa

16 Interpretação de RAPDs Marcadores RAPD são anônimos Dados binários (presença x ausência) RAPD são dominantes (AA = Aa) Problemas de co-migração mesma banda, mesmo fragmento? uma banda, um fragmento? Questionamento para filogenia banda homólogas?

17 PCR com primers arbitrários: acúmulo de siglas! RAPD Random Amplified Polymorphic DNA DAF DNA Amplification Fingerprinting AP-PCR Arbitrarily Primed Polymerase Chain Reaction MAAP Multiple Arbitrary Amplicon Profiling (sugerido por incluir todas as pequenas variações na técnica)

18 Diferenças entre ensaios com primers arbitrários RAPD 10mers, gel de agarose corado com brometo DAF 5mers, gel de acrilamida e reação marcada 32 P AP-PCR 10mers, gel de acrilamida e reação marcada 32 P

19 GEL RAPD

20 RAPD - resumo Rápido Simples Baixo custo Sem uso de radio-isótopos Marcador dominante Problemas de reproducibilidade Problemas de interpretação

21 Microssatélites Sequence-Tagged Microsatélites (STMS) também conhecido como microssatélite ou Simple Sequence Repeat (SSR) Normalmente locus simples e multi-alélico Co-dominante Altamente reprodutível

22 Microssatélites Seqüências curtas (1 a 6 bases) repetidas em tandem Presentes em procariotos e eucariotos Presentes em regiões codificantes e não codificantes Maioria das repetições são dinucleotídeos (AC) n (AG) n (AT) n

23 Polimorfismo devido a diferenças no número de repetições Escorregamento da DNA polimerase durante a replicação Crossing-over desigual entre cromátides irmãs Codominantes Normalmente locos simples e multi-alélico Microssatélites

24 altamente informativo - vários alelos por locos detecção por PCR facilmente transferível entre labs distribuição homogênea no genoma

25 Microssatélites NNNNNNNNNNNNNNNNNNNNN CACACACACACACACACAC NNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNN GTGTGTGTGTGTGTGTGTG NNNNNNNNNNNNNN Primer REV Primer FOR Repetição CA

26 Microssatélites Obtenção de seqüências: a partir de banco de dados de genoma ou cDNA hibridação com biblioteca genômica, identificação de clones e seqüenciamento construção de biblioteca enriquecida por afinidade com seqüência da matriz

27 Detecção do polimorfismo Géis de agarose Géis de acrilamida (detecta diferenças de até 2pb) coloração direta: nitrato de prata (barato) Coloração indireta: marcação radioativa ou fluorescente Microssatélites

28 Análise Microssatélites

29 Problemas Custo e trabalho envolvidos no desenvolvimento dos primers Construção de bibliotecas genômica sequenciamento Triagem dos melhores primers Possibilidade de se usar seqüências depositadas em banco de dados EST (Expressed Sequence Tags) - SSR funcional x SSR genômico Microssatélites

30 RFLPRAPDSSR PolimorfismoPontual ou InDel Nº de Rep. Nível do PolimorfismoMédio Alto AbundânciaAltaMédiaMédiaAlta DominânciaCo-DominanteDominanteCo-Dominante [DNA]10 ug25 ng50 ng MarcaçãoSim/NãoNão RepetibilidadeAltaBaixaAlta Comparação entre Marcadores


Carregar ppt "Introdução à análise por marcadores moleculares Prof. Vinicius Campos Disciplina de Biotecnologia Animal Graduação em Biotecnologia UFPel."

Apresentações semelhantes


Anúncios Google