A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Marcadores Moleculares Introdução e Histórico Descrição de Marcadores Comparação entre Marcadores Moleculares Classificação de Marcadores Moleculares Características.

Cópias: 1
Biotecnologia LZT 310 Antonio Figueira Laboratório de Melhoramento de Plantas Centro de Energia Nuclear na Agricultura Universidade de São Paulo

Apresentações semelhantes


Apresentação em tema: "Marcadores Moleculares Introdução e Histórico Descrição de Marcadores Comparação entre Marcadores Moleculares Classificação de Marcadores Moleculares Características."— Transcrição da apresentação:

1 Marcadores Moleculares Introdução e Histórico Descrição de Marcadores Comparação entre Marcadores Moleculares Classificação de Marcadores Moleculares Características do Genoma de Planta Aplicações –diversidade genética –mapeamento e seleção assistida

2 INTRODUÇÃO E HISTÓRICO Marcadores Moleculares

3 Genética arte e seleção inconsciente –da invenção da agricultura até séc. XIX 1900s - Descoberta dos princípios genéticos Melhoramento genético científico –genética quantitativa e biometria –(fenótipo é previsor ruim do valor genético!) Utilização de marcadores genéticos moleculares

4 Sucesso no melhoramento depende da capacidade de distinguir fatores genéticos herdáveis dos ambientais Marcadores genéticos são unidades herdáveis simples marcadores cromossoma

5 Polimorfismo de DNA resulta acúmulo de mutações –pontual ou inserção/deleção –macro-rearranjos: translocações, inversões, deleções

6 1. Mutações pontuais - SNPs A.ATCTCGTGATTCCTAGTCGTA TAGAGCACTAAGGGATCAGCAT ex. Sítio EcoRI B.ATCTCGTGATTATAGTCGTA TAGAGCACTAATATCAGCAT 2. Pequenas deleções e/ou inserções - InDels A.ATCTCGTCTAGTCGTA TAGAGCAGATCAGCAT B.ATCTCGT---GTCGTA TAGAGCA---CAGCAT Origem do Polimorfismo Molecular

7 Histórico de Marcadores 1. Karl Sax (1923): propôs método para localização de QTLs ligação entre genes de característica qualitativa (cor de semente) e quantitativa (peso de semente); Problema: ausência de mutações múltiplas em estoque de elite, baixa viabilidade 2. Hunter & Markert (1957) - marcas bioquímicas desenvolveram isoenzimas em gel de amido

8 Histórico de Marcadores 3. Hubby & Lewotin (1966) demonstraram que 30% de loci de isoenzimas exibiam polimorfismo em populações selvagens de Drosophila; s - ferramentas moleculares desenvolvimento de vetores de clonagem; enzimas de restrição; polimerases; ligases; Southern (1977);

9 Histórico de Marcadores 5. RFLP proposto por Botstein et al. (1980) descrito para humanos 6. PCR proposto por Mullis & Faloona (1987) 7. VNTR por Jeffrey (1987) 8. RAPD por Rafalski et al. (1990)

10 Histórico de Marcadores 9. SSR em plantas por Akkaya et al. (1992) 10. AFLP por Zabeau & Vos (1993) 11. CAPS por Konieczny & Ausubel (1993) 12. SCAR por Paran & Michelmore (1993) 13. Cho et al. (1999) - SNPs em Arabidopsis

11 DESCRIÇÃO DOS MARCADORES MOLECULARES

12 Marcadores Moleculares RFLP VNTR (minissatélite) RAPD, AP-PCR, DAF PCR-específico - SSR, ISSR, CAPS, SCARs AFLP SNPs

13 Restriction Fragment Length Polymorphism - RFLP RFLP examina diferença em tamanho de fragmentos de restrição de DNA específicos Polimorfismo deriva de mutação pontual, inserção, deleção Utiliza-se DNA celular total Requer DNA puro de alto peso molecular

14 Metodologia de RFLP 1. Digerir DNA em fragmentos pequenos 2. Separação dos fragmentos por gel eletroforese 3. Transferência de fragmentos de DNA para filtro Fonte: IPGRI

15 Metodologia de RFLP 4. Visualização dos fragmentos de DNA –sondas marcadas ( 32 P) ou a frio 5. Análise dos resultados –bandas analisadas para alelos e/ou presença/ausência –diferenças em padrão de bandas reflete diferenças genéticas A escolha de sonda/enzima de restrição é crucial Fonte: IPGRI

16 digestão DNA Digestão de DNA Genômico e Separação em Gel Separação em gel

17 Transferência para Membrana de Nylon ou Nitrocelulose

18 Hibridização em Nylon ou Nitrocelulose

19 Construção de biblioteca genômica ou de cDNA mRNA ou DNA cDNA Clone cDNA Biblioteca de cDNA

20 Eletroforese

21 Hibridização com sonda marcada Exposição em filme de Raios-X

22 Interpretação de resultados Sítio alvo para sonda Sítio de restrição Inserção Fonte: IPGRI

23 SorgoCana RFLP em Cana de Açúcar

24 Hibridização com sonda de sorgo P1 P2 1:1 3:1

25 Hibridização com sonda de Cana 1:1 3:1

26 6 Kb A Herança de RFLPs 8 Kb B 6 Kb F1F1 8 Kb 6 Kb 8 Kb 6 Kb 8 Kb F2F2

27 Análise de Diversidade e Filogenia por RFLP ABC 4 ABC

28 RFLP: sondas de locos único DNA Nuclear –biblioteca genômica –biblioteca de cDNA DNA Citoplasmático –biblioteca de DNA cloroplástico e mitocondrial Sondas de RFLP são: –locos-específica, co-dominante –espécie-específica

29 RFLP: sondas multi-locus Repetições em linha (tandem) - útil –encontrada em vários loci –altamente polimórficas Sequência de Minissatélite –VNTR: variable number of tandem repeats –uso em DNA fingerprinting –uso de seqüências repetidas de fago M13

30 Interpretação dos resultados A1A1 A1A2 A2A3 A1 A1 A2 A2 A3 Repetição Sítio de Restrição Fonte: IPGRI

31 Vantagens e Desvantagens de RFLP Reprodutível Marcadores co-dominantes Simples Trabalhoso Caro Uso de sondas radioativas* Fonte: IPGRI

32 Random Amplification of Polymorphic DNA - RAPD Amplifica seqüências anônimas de DNA usando primers arbitrários –10 bases com >50% G+C PCR com um único primer Método rápido para detecção de polimorfismos Marcador dominante Problemas de reproducibilidade

33 RAPD AA Aa aa AA Aaaa

34 Interpretação de RAPDs Marcadores RAPD são anônimos Dados binários (presença x ausência) RAPD são dominantes (AA = Aa) Problemas de co-migração –mesma banda, mesmo fragmento? –uma banda, um fragmento? Questionamento para filogenia –banda homólogas?

35 PCR com primers arbitrários: acúmulo de siglas! RAPD –Random Amplified Polymorphic DNA DAF –DNA Amplification Fingerprinting AP-PCR –Arbitrarily Primed Polymerase Chain Reaction MAAP –Multiple Arbitrary Amplicon Profiling (sugerido por incluir todas as pequenas variações na técnica) Fonte: IPGRI

36 Diferenças entre ensaios com primers arbitrários RAPD –10mers, gel de agarose corado com brometo DAF –5mers, gel de acrilamida e reação marcada 32 P AP-PCR –10mers, gel de acrilamida e reação marcada 32 P

37 RAPD - resumo Rápido Simples Baixo custo Sem uso de radio-isótopos Marcador dominante Problemas de reproducibilidade Problemas de interpretação Fonte: IPGRI

38 RAPD - primer OPJ04 - Bananeira 1500 pb

39 RAPD - Feijoeiro OPAM13 OPY04

40 Sítio de Seqüência Dirigida (Sequence-tagged sites) Sequence-Tagged Microssatélites (STMS) ou SSR ou Microssatélites Microssatélites ancorados –Inter-Simple Sequence Repeat (ISSR) Sequence-characterized amplified regions (SCARs) Cleaved amplified polymorphic sequence (CAPS) – PCR-RFLP Fonte: IPGRI

41 Microssatélites (SSR) Sequence-Tagged Microsatélites (STMS) –também conhecido como microssatélite ou Simple Sequence Repeat (SSR) Normalmente locus simples e multi- alélico Co-dominante Altamente reprodutível

42 Microssatélites STMS ou SSRs –Seqüências curtas (1 a 6 bases) repetidas em tandem –Presentes em procariotos e eucariotos –Presentes em regiões codificantes e não codificantes –Maioria das repetições são dinucleotídeos (AC) n (AG) n (AT) n

43 Polimorfismo devido a diferenças no número de repetições –Escorregamento da DNA polimerase durante a replicação –Crossing-over desigual entre cromátides irmãs Codominantes Normalmente locos simples e multi-alélico Microssatélites

44 Microssatélites (SSR) altamente informativo - vários alelos por locos detecção por PCR facilmente transferível entre labs distribuição homogênea no genoma

45 Microssatélites (SSR) NNNNNNNNNNNNNNNNNNNNN CACACACACACACACACAC NNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNN GTGTGTGTGTGTGTGTGTG NNNNNNNNNNNNNN Primer REV Primer FOR Repetição CA

46 Microssatélites (SSR) Obtenção de seqüências: a partir de banco de dados de genoma ou cDNA hibridação com biblioteca genômica, identificação de clones e seqüenciamento construção de biblioteca enriquecida por afinidade com seqüência da matriz

47 Detecção do polimorfismo –Géis de agarose –Géis de acrilamida (detecta diferenças de até 2pb) coloração direta: nitrato de prata (barato) Coloração indireta: marcação radioativa ou fluorescente Microssatélites

48 Problemas –Custo e trabalho envolvidos no desenvolvimento dos primers Construção de bibliotecas genômica sequenciamento Triagem dos melhores primers Possibilidade de se usar seqüências depositadas em banco de dados EST – SSR funcional x SSR genômico Microssatélites

49 Microssatélites (SSR) NNNNNNNNNNNNNNNNNNNNN CACACACACACACACACAC NNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNN GTGTGTGTGTGTGTGTGTG NNNNNNNNNNNNNN Primer REV Primer FOR Repetição CA

50 Nicotiana tabacum DNA genômico total Seqüência microssatélite Adaptadores Sonda biotinilada Bolinha magnética- estratividina ssDNA Coluna Digestão Ligação Adaptadores Amplificação Enriquecimento e Seleção Amplificação após enriquecimento

51 Enriquecimento e Seleção Coluna Magnética Temperatura ambiente / 20 min ssDNA Sonda biotinilada Biotina IIIII(CT)8 ou Biotina IIIII(GT)8 95°C / 15 min água

52 Dna Total Digestão com RsaI Amplificação Amplificação após enriquecimento Ligação com adaptadores Nicotiana ripanda N. sylvestris N. tabacum Coker 176 N. tabacum Ky 14 RMI

53 Vetor Clonagem PCR Sequenciamento Desenho de primers Transferência e Southern blot Transformação e Seleção Meio LB + amp + X-gal + IPTG

54 N. sylvestris N. tabacum Coker 176 Até 24/02/05 Todas as placas foram testadas

55 Microssatélites (SSR) Southern blot - clones SSRs positivos 32 P Amplificação insertos clonados

56 Microssatélites (SSR) (TC) 15 (AG) 14

57 >ZZFIGCO001g_A04_.g_033_Rome.ab1 CHROMAT_FILE: CGATTGGGCCGACGTCCATGCTCCGGNNCGCATGTCGGCCGCGGGAATTCGATTCTCTTGCTTACGCGTGGACTAGCTTACAATA GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGTTTTGGCTGATGCCTTATCTCAAAAG AAGAAACGACCCTATATATAGAAAAGAAAAAAACAGAAAGAATCTATGCACAGTAAAGTAGGTCCCATATGTGGGTCCCTTATACAGT GTATTTACTGTGTATACAATATTTCTACTATATAAACAATGTATCTACTGTTGAGTGGGTCGGCGGCCTCACTGTTGATCATATTCCAC GTCTCTCTAATTCTTTCATCTGTTGGATGAAATCTTCCGCATTTTCTACAGCTTCGTCAGATAATATCTTCTCCGATTGAATAGGCTGA GAATCTTCTGCAATATCATCGTTGCTTGTTTCACTTCGCATTAAAGTGTCAGATTTTTCATACTGGTTAATAGATTGAAGTAAGTTTCTT TTTACTTCTTCCAAATACTTATTAATCAATTTCTATAAGATAAACATATAAGTTCAGATCCAGGCACATAATTATAACCATGCGTTTTCA CACGTATTTGTCAAAATAAGTCTGCATTTCTCACTTCTTTTTCCTGGTTAAGACCCGTTATACCCTCCAATTATACTTGGAACACCTTT TATCGGCGCTATTTATCCTTTTACTAGCATAGATTCTAAAGGATTTACCACAACTTATAAAAATAAAAGAATAGGTTATACCTTTGTTAC CGATCCCGTAACTAGGGGATATAATGGCTTTATTAGATATAAATCCAAAATATATT (AG) 30

58 Microssatélites Bananeira 3x e 4x Cir 24.25

59 Microssatélites Seta: alelos genoma B

60 Microssatélites Ancorados ISSR Amplificação de segmentos genômicos flanqueados por repetições Anelamento locos-específico Inter-simple sequence repeats (ISSR) –ancorados na extremidade 3 ou 5 Marcadores dominantes Microssatélites mais úteis que minissatélites

61 Microssatélites Ancorados ISSR NNNNNNNNN CACACACACACACAC NNNNNNNNNNNN CACACACACACACAC NNNNN NNNNNNNNNGTGTGTGTGTGTGTG NNNNNNNNNNNN GTGTGTGTGTGTGTG NNNNN (CA) n NN NNNNN (CA) n Repetição CA ISSR 5 ou 3ancorado

62 ISSR UBC 811 UBC 816 Nanicão Jangada Control Variante Anão NA

63 SCARs SCARs - sequence-characterised amplified regions –proposto por Paran & Michelmore (1993) –marcador locus-único derivado de fragmentos sequenciados de RAPD, ISSR, AFLP –maior estabilidade - primers específicos –analisado para presença/ausência –possibilidade de simplificação de análise e automação

64 SCARs R * S clonar Primer específicoSeqüenciar

65 SCAR - Feijoeiro ROC20 460

66 CAPS ou PCR-RFLP CAPS - cleaved amplified polymorphic sequence –marcador locus-específico –produto amplificado por PCR e analisado por RFLP –seqüência de banco de dados, clones de cDNA ou genômico –codominante

67 CAPS AB Locus Seqüenciado - primers específicos AB PCR específico Digestão com Enzimas Corte freqüente ABAB 1 2 locus Enzimas de Restrição AluI HaeIII MboI

68 CAPS - Feijoeiro

69

70 Amplified Fragment Length Polymorphism - AFLP Combinação de RFLP e PCR Resulta em padrões muito informativos Marcador dominante Método cada vez mais usado

71 DNA genômico digestão com duas enzimas adaptadores EcoRI MseI pré-amplificação amplificação seletiva ligação MseI EcoRI

72 GAATTCCN CTTAAGCN NTTAA NAATT ATTCCN GCN NT NAAT DNA digestão EcoRI MseI ATTCCN GCN NT N ATTAA ligação TA ATTCCN TAAGCN NTTA NAAT pré- amplificação primer +1 A C amplificação primer +3 ATTCCA TAAGCT GTTA CAAT AAC

73

74 AFLP de cana com 33 P

75 AFLP de feijão gel desnaturante corado com prata

76 Marcadores derivados de Retrotransposons

77 COMPARAÇÃO ENTRE MARCADORES MOLECULARES

78 Escolha de Marcadores Característica RFLP RAPD SSR AFLP ISSR CAPS Polimorfismo Pontual Pontual # Pontual Pontual Pontual InDel InDel Rep. InDel InDel InDel Nível de Polimorfismo médio médio alto médio médio baixo Abundância alta m.alta média m.alta média alta Dominância CoDom Dom CoDom Dom Dom CoDom [DNA] 10 g 25 ng 50 ng 500 ng 25 ng 25 ng Seqüência não não sim não não sim Marcação sim/não não não sim/não não não Repetibilidade alta baixa alta média baixa alta

79 CLASSIFICAÇÃO DE MARCADORES MOLECULARES

80 Classificação por Tipo de Técnica Métodos sem uso de PCR RFLP VNTR Métodos com uso de PCR –PCR com primers arbitrários RAPD, AP-PCR, DAF, MAAP; Polimorfismo de Tamanho de Fragmento Amplificado AFLP; ISSR –PCR sítio-específico CAPS, SCAR SSRs (microssatélites) TGGE, SSCP, DGGE

81 Classificação por Número de Cópias da Seqüência Alvo Seqüência de poucas cópias - codificante RFLP Seqüência com cópias repetidas VNTR SSRs (microssatélites) ISSR Seqüência com número de cópias indefinido RAPD, AP-PCR, DAF, MAAP; AFLP; CAPS, SCAR


Carregar ppt "Marcadores Moleculares Introdução e Histórico Descrição de Marcadores Comparação entre Marcadores Moleculares Classificação de Marcadores Moleculares Características."

Apresentações semelhantes


Anúncios Google