A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Prof. Vinicius Campos. Seqüenciamento 2 principais fases 1) produção de moléculas - bibliotecas de gDNA, cDNA, etc. 2) seqüenciamento propriamente dito.

Apresentações semelhantes


Apresentação em tema: "Prof. Vinicius Campos. Seqüenciamento 2 principais fases 1) produção de moléculas - bibliotecas de gDNA, cDNA, etc. 2) seqüenciamento propriamente dito."— Transcrição da apresentação:

1 Prof. Vinicius Campos

2 Seqüenciamento 2 principais fases 1) produção de moléculas - bibliotecas de gDNA, cDNA, etc. 2) seqüenciamento propriamente dito - Sanger

3 Introdução Maior velocidade Maior eficiência Menor custo Ferramentas de seqüenciamento buscam:

4 Tecnologias de sequenciamento - Sanger sequencing - PNAS 74 (1977), n. 12, Sequenciador MegaBACE (1Mpb/24 horas) - Pirosequenciamento -Nature 437 (2005), Sequenciador 454 (150Mpb/24 horas)

5 Revolução sequencing Massively parallel amplification pyrosequencing EmPCR – Emulsion PCR

6 Inovações Comerciais

7 Roche 454

8 Princípios do Pirossequenciamento

9

10

11

12 e.g. N at position 1 Fluorescence-labeled decoder for nucleotide G A T C Call for base at position 1G Princípios do Pirossequenciamento

13 Visão da Placa de pirossequenciamento pelo equipamento

14 (75,179) (188,358) (75,179) (188,358) G G 1

15 (75,179) (188,358) (75,179) (188,358) GA GA 12

16 (75,179) (188,358) (75,179) (188,358) GAT GAT 123

17 (75,179) (188,358) (75,179) (188,358) GATC GATC 1234

18 (75,179) (188,358) (75,179) (188,358) GATC GATC 1234 T G 5

19 (75,179) (188,358) HUMFTE1A HSRNPA1 GATC GATC 1234 TTACCCGTGACAAAT GTGACGCTGAATAAT A A

20 Sequencia de uma bead específica G A T C C C A G T G A A T C C T G G G T

21 Signature GATCTGCATTCGGTAACAGG1 2GATCTTTGTCAACCAAAACA2 3GATCCCTGTGAAGACCCAGG113 4GATCTTTCCTCCTGGTTACT16 5GATCCAGTCAAGGAGAAAGA3 6GATCTGATAGTCCTGAAAAC22 7GATCATGGTGATGTACGGGG1 8GATCCAGTGCTATTCTGTCA38 9GATCAATCCCTCAAGATTTT ,685GATCACCATCCCAGTCACCT2, ,567 # of Beads 1

22 Vantagens Maior rapidez no sequenciamento Sequenciamento simultâneo Menor custo Menos erros na leitura

23 Novas possibilidades Aprofundar regulação genoma Acompanhar resistência viral e bacteriana em tempo real Ter acesso a novos genes Entender a terapêutica gênica Integrar informações biológicas com questões de saúde e doença Avaliação genômica personalizada Avanços ainda inimagináveis

24

25 Aplicações comerciais atuais... https://www.23andme.com/www.23andme.com


Carregar ppt "Prof. Vinicius Campos. Seqüenciamento 2 principais fases 1) produção de moléculas - bibliotecas de gDNA, cDNA, etc. 2) seqüenciamento propriamente dito."

Apresentações semelhantes


Anúncios Google