A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Novas tecnologias no seqüenciamento de dna

Apresentações semelhantes


Apresentação em tema: "Novas tecnologias no seqüenciamento de dna"— Transcrição da apresentação:

1 Novas tecnologias no seqüenciamento de dna
Prof. Vinicius Campos

2 Seqüenciamento 2 principais fases 1) produção de moléculas
- bibliotecas de gDNA, cDNA, etc. 2) seqüenciamento propriamente dito - Sanger

3 Introdução Ferramentas de seqüenciamento buscam: Maior velocidade
Maior eficiência Menor custo

4 Tecnologias de sequenciamento
Sanger sequencing PNAS 74 (1977), n. 12, Sequenciador MegaBACE (1Mpb/24 horas) Pirosequenciamento Nature 437 (2005), 362-7 Sequenciador 454 (150Mpb/24 horas)

5 Revolução... 2005 454 sequencing “Massively parallel amplification” pyrosequencing EmPCR – “Emulsion PCR”

6 Inovações Comerciais

7 Roche 454

8 Princípios do Pirossequenciamento

9 Princípios do Pirossequenciamento

10 Princípios do Pirossequenciamento

11 Princípios do Pirossequenciamento

12 Princípios do Pirossequenciamento
e.g. N at position 1 Fluorescence-labeled decoder for nucleotide G A T C Call for base at position 1 G

13 Visão da Placa de pirossequenciamento pelo equipamento

14 (75,179) G (188,358) G 1 (75,179) (188,358)

15 (75,179) G A (188,358) G A 1 2 (75,179) (188,358)

16 (75,179) G A T (188,358) G A T 1 2 3 (75,179) (188,358)

17 (75,179) G A T C (188,358) G A T C 1 2 3 4 (75,179) (188,358)

18 (75,179) G A T C T (188,358) G A T C G 1 2 3 4 5 (75,179) (188,358)

19 (75,179) (188,358) HUMFTE1A HSRNPA1 G A T C T T A C C C G T G A C A A
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 (75,179) (188,358)

20 Sequencia de uma bead específica
G A T C C C A G T G A A T C C T G G G T

21 Signature GATCTGCATTCGGTAACAGG 1 2 GATCTTTGTCAACCAAAACA 3 GATCCCTGTGAAGACCCAGG 113 4 GATCTTTCCTCCTGGTTACT 16 5 GATCCAGTCAAGGAGAAAGA 6 GATCTGATAGTCCTGAAAAC 22 7 GATCATGGTGATGTACGGGG 8 GATCCAGTGCTATTCTGTCA 38 9 GATCAATCCCTCAAGATTTT 312 . 23,685 GATCACCATCCCAGTCACCT 2,588 856,567 # of Beads

22 Vantagens Maior rapidez no sequenciamento Menor custo
Sequenciamento simultâneo Menor custo Menos erros na leitura

23 Novas possibilidades Aprofundar regulação genoma
Acompanhar resistência viral e bacteriana em tempo real Ter acesso a novos genes Entender a terapêutica gênica Integrar informações biológicas com questões de saúde e doença Avaliação genômica personalizada Avanços ainda inimagináveis

24

25 Aplicações comerciais atuais...
https://www.23andme.com/


Carregar ppt "Novas tecnologias no seqüenciamento de dna"

Apresentações semelhantes


Anúncios Google