A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Genótipo; Fenótipo; Plasticidade fenotípica. A morfologia pode ser plástica! ATTTCGCCCTTTAAATAT AMBIENTE.

Apresentações semelhantes


Apresentação em tema: "Genótipo; Fenótipo; Plasticidade fenotípica. A morfologia pode ser plástica! ATTTCGCCCTTTAAATAT AMBIENTE."— Transcrição da apresentação:

1

2

3 Genótipo; Fenótipo; Plasticidade fenotípica.

4 A morfologia pode ser plástica! ATTTCGCCCTTTAAATAT AMBIENTE

5 Plasticidade fenotípica e as mudanças ambientais

6

7

8

9

10 ATATATTCCGCGCCTCCTGATAGATAGCTCTCTCTAGATCGATCGATCG ATATCTATCTATCTTTTTGTGTGTGTCTCTCTCTATATCTATCTATCTATC TCTCTCTTCCCCCCTTTTTATATATATATATCTCGCTCGCTCGATACGTT ATATATTCCGCGCCTCCTGATAGATAGCTCTCTCTAGATCGATCGATCG ATATCTATCTATCTTTTTGTGTGTGTCTCTCTCTATATCTATCTATCTATC TCTCTCTTCCCCCCTTTTTATATATATATATCTCGCTCGCTCGATACGTT ATATATTCCGCGCCTCCTGATAGATAGCTCTCTCTAGATCGATCGATCG ATATCTATCTATCTTTTTGTGTGTGTCTCTCTCTATATCTATCTATCTATC TCTCTCTTCCCCCCTTTTTATATATATATATCTCGCTCGCTCGATACGTT

11 Composição e estrutura DNA - ácido desoxirribonucleico – Cadeia de polinucleotídeos AG Nucleotídeos Purinas A e G CT Pirimidinas C e T

12

13

14

15 1.Número grande de indivíduos; 2.Acasalamento aleatório; 3.Sem seleção; 4.Sem mutação; 5.Sem migrações.

16

17

18

19

20

21

22

23

24

25

26

27

28

29 ecossistema

30

31 Crescimento populacional explosivoPerda por extinção Ciência descobre novos usos

32

33

34

35

36

37

38

39

40

41

42 1.A diversidade das espécies tende a aumentar em direção ao equador: sistemas em latitudes baixas tendem a apresentar maior diversidade local e entre sistemas; 2.Em ilhas, topos de montanha e outros sistemas isolados, a diversidade de espécies tende a aumentar com a área e a decrescer com o isolamento; 3.O endemismo tende a ser mais alto em regiões maiores e mais isoladas; 4.Extinções são mais comuns para espécies com amplitudes menores.

43

44

45 D=1/(pA 2 +pB 2 +pC 2 +pD 2 +pE 2 )

46

47

48

49

50 Onze dos 80 cetáceos atuais foram descobertos no século XX, um deles, em 1991; Três novas famílias de angiospermas foram descobertas no México durante a última década; Dois novos filos foram descobertos durante os anos de 1990, um (Loricifera) no meio aquático e o outro (Cycliophora), agarrado em partes bucais de lagostas; Talvez 90% dos insetos de florestas tropicais permaneçam desconhecidos; Quase 1,5 milhão de fungos ainda estão por serem descobertos.

51

52

53

54 Depende da escala espacial e taxonômica Originam-se no local e nunca se dispersaram Fruto de sobrevivência apenas em uma pequena parte de sua amplitude maior Coincidência de endemismos

55

56

57

58

59

60

61

62

63

64

65

66

67

68

69 Rio Grande do Sul: Sub-região Paranaense: parte da Província do Bosque de Araucaria angustifolia, parte da Província do Bosque Paranaense; parte da Província do Bosque Atlântico Brasileiro; parte da Província do Pampa.


Carregar ppt "Genótipo; Fenótipo; Plasticidade fenotípica. A morfologia pode ser plástica! ATTTCGCCCTTTAAATAT AMBIENTE."

Apresentações semelhantes


Anúncios Google