A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Quando vejo estas ilhas tão próximas umas das outras e possuidoras de escassos animais, habitadas por estes pássaros apenas ligeiramente diferentes.

Apresentações semelhantes


Apresentação em tema: "Quando vejo estas ilhas tão próximas umas das outras e possuidoras de escassos animais, habitadas por estes pássaros apenas ligeiramente diferentes."— Transcrição da apresentação:

1

2

3 Quando vejo estas ilhas tão próximas umas das outras e possuidoras de escassos animais, habitadas por estes pássaros apenas ligeiramente diferentes em estrutura e ocupando o mesmo espaço da natureza, devo suspeitar que eles são apenas variedades (...) C. DARWIN.

4 Charles Lyell e o Uniformitarismo

5

6 1.A variação, sob a forma de diferenças individuais, existe em todas as espécies ou populações; 2.Todos os organismos produzem descendentes em número muito maior do que aquele que sobrevive até a idade reprodutiva; CONCLUSÃO: Existe competição ou luta pela sobrevivência, na qual indivíduos são eliminados;Existe competição ou luta pela sobrevivência, na qual indivíduos são eliminados; As características dos indivíduos que são favorecidos neste processo de eliminação são transmitidas à geração seguinte e às futuras.As características dos indivíduos que são favorecidos neste processo de eliminação são transmitidas à geração seguinte e às futuras.

7

8 Taxonomia evolutiva X X Toda espécie apareceu coincidente no tempo e no espaço a partir de uma outra espécie (um ancestral pré-existente)

9 Relações de ordem parcial irreflexivaassimétricatransitiva Relação de ordem parcial estrita: irreflexiva, assimétrica e transitiva ser ancestral de A relação ser ancestral de é! AB x x A B X = A B X I = {1,2,3} A I = {1,2,3,4} B I = {1,2,3,5}

10

11

12

13

14

15 Anagênese e cladogênese Reticulados (recombinação gênica) Divergência

16

17 Um loco gênico, dois estados (A, a)-uma população diplóide n1 + n2 + n3 = N GENÓTIPO NÚMERO Frequência do alelo A = a = n1+1/2n2 N

18

19

20

21 1.Pressão das mutações; 2.Fluxo gênico; 3.Seleção natural; 4.Deriva genética.

22

23 Δp=up o (por geração) p 1 =p o (1-u) t O alelo acabará desaparecendo da população!!! Se u=10 -5 e p 0= 0,96, seriam necessária gerações para se ter p = 0,48 A a Gene mutante é mais frequente?

24 ATATATTCCGCGCCTCCTGATAGATAGCTCTCTCTAGATCGATCGATCG ATATCTATCTATCTTTTTGTGTGTGTCTCTCTCTATATCTATCTATCTATC TCTCTCTTCCCCCCTTTTTATATATATATATCTCGCTCGCTCGATACGTT ATATATTCCGCGCCTCCTGATAGATAGCTCTCTCTAGATCGATCGATCG ATATCTATCTATCTTTTTGTGTGTGTCTCTCTCTATATCTATCTATCTATC TCTCTCTTCCCCCCTTTTTATATATATATATCTCGCTCGCTCGATACGTT ATATATTCCGCGCCTCCTGATAGATAGCTCTCTCTAGATCGATCGATCG ATATCTATCTATCTTTTTGTGTGTGTCTCTCTCTATATCTATCTATCTATC TCTCTCTTCCCCCCTTTTTATATATATATATCTCGCTCGCTCGATACGTT

25 Composição e estrutura DNA - ácido desoxirribonucleico – Cadeia de polinucleotídeos AG Nucleotídeos Purinas A e G CT Pirimidinas C e T

26

27

28

29

30 Δp=m(pm-po)Δp=m(pm-po)

31

32

33

34

35

36 1.Reprodução; 2.hereditariedade; 3.Variação; 4.Variação da aptidão do organismo.

37

38 A morfologia pode ser plástica! ATTTCGCCCTTTAAATAT AMBIENTE W=1-s

39 manutenção

40

41 A anemia falciforme é um polimorfismo com vantagem do heterozigoto

42

43

44

45 Plasticidade fenotípica e as mudanças ambientais

46

47

48

49

50

51 Diminuição do tamanho corporal Aumento do tamanho corporal

52

53 Geralmente, fêmeas maiores que os machos fêmea mach o oviposição fêmea mach o oviposição Back- brooders Emergent-brooders ou Nepoidea Belostomatinae

54 macho fêmea macho fêmea Laccotrephes japonensis Kirkaldyia deyrolli Appasus japonicus A. major Comprimento total (mm) Dimorfismo sexual é menor em insetos pequenos

55

56

57

58 Espécies não necessariamente representam pontos independentes de dados! Evite confundir-se com efeitos filogenéticos (INÉRCIA FILOGENÉTICA E MOVIMENTO BROWNIANO) Métodos comparativos tentam detectar adaptação no estudo da evolução de uma característica!


Carregar ppt "Quando vejo estas ilhas tão próximas umas das outras e possuidoras de escassos animais, habitadas por estes pássaros apenas ligeiramente diferentes."

Apresentações semelhantes


Anúncios Google