A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Ação do hormônio tireoidiano e de seu receptor sobre o promotor do fator de necrose tumoral alfa Nome: Fellipe Erick Campos Orientadora: Angélica Amorin.

Apresentações semelhantes


Apresentação em tema: "Ação do hormônio tireoidiano e de seu receptor sobre o promotor do fator de necrose tumoral alfa Nome: Fellipe Erick Campos Orientadora: Angélica Amorin."— Transcrição da apresentação:

1 Ação do hormônio tireoidiano e de seu receptor sobre o promotor do fator de necrose tumoral alfa Nome: Fellipe Erick Campos Orientadora: Angélica Amorin Amato

2 Eixo hipotálamo-hipófise-tireoide Tireoide Hipófise T4 + T3 Circulação Tecidos Hipotálamo Tecidos

3 Desenvolvimento Homeostase Proliferação e diferenciação celular Efeitos fisiológicos do hormônio tireoidiano SNC Temperatura corporal Consumo de oxigênio Frequência cardíaca Metabolismo de nutrientes Sistema Nervoso Central Atividade de outros hormônios SNC Função reprodutiva

4 Histonas desacetiladas Histonas acetiladas Transcrição - T3 + T3 Mecanismo de ação do hormônio tireoidiano

5 HIPOTIREOIDISMO Bradicardia Pele ressecada e fria Hipoglicemia Hipercolesterolemia Redução da taxa metabólica basal HIPERTIREOIDISMO Taquicardia Pele quente e úmida Hiperglicemia Hipocolesterolemia Aumento da taxa metabólica basal Deficiência x excesso de hormônio tireoidiano

6 Hipotireoidismo franco e aparelho cardiovascular – frequência e contratilidade cardíaca – expressão de genes que codificam enzimas que regulam contratilidade e relaxamento cardíaco Thyroid hormone and the cardiovascular system: from theory to practice. J Clin Endocrinol Metab 1994; 78:1026. Biochemical basis of thyroid hormone action in the heart. Am J Med 1990; 88:626. Thyroid hormone and the cardiovascular system: from theory to practice. J Clin Endocrinol Metab 1994; 78:1026. Biochemical basis of thyroid hormone action in the heart. Am J Med 1990; 88:626. Hipotireoidismo x doença cardiovascular

7 Subclinical hypothyroidism is an independent risk factor for atherosclerosis and myocardial infarction in elderly women: the Rotterdam Study. Ann Intern Med 2000: 132:270. Risk for ischemic heart disease and all-cause mortality in subclinical hypothyroidism. J Clin Endocrinol Metab 2004; 89: Subclinical hypothyrodism is associated with a low-grade inflammation, increased triglyceride levels and predicts cardiovascular disease in males below 50 years. Clin Endocrinol (Oxf) 2004; 61:232. Impaired endothelium-dependent vasodilation in subclinical hypothyroidism: beneficial effect of levothyroxine therapy. J Clin Endocrinol Metab 2003; 88:3731 Subclinical hypothyroidism is an independent risk factor for atherosclerosis and myocardial infarction in elderly women: the Rotterdam Study. Ann Intern Med 2000: 132:270. Risk for ischemic heart disease and all-cause mortality in subclinical hypothyroidism. J Clin Endocrinol Metab 2004; 89: Subclinical hypothyrodism is associated with a low-grade inflammation, increased triglyceride levels and predicts cardiovascular disease in males below 50 years. Clin Endocrinol (Oxf) 2004; 61:232. Impaired endothelium-dependent vasodilation in subclinical hypothyroidism: beneficial effect of levothyroxine therapy. J Clin Endocrinol Metab 2003; 88:3731 Hipotireoidismo subclínico e aparelho cardiovascular – incidência de doença aterosclerótica – mortalidade cardiovascular Hipotireoidismo x doença cardiovascular

8 resistência vascular periférica piora de hipertensão arterial sistêmica Hipercolesterolemia Hiperhomocisteinemia Doença cardiovascular aterosclerótica x inflamação sistêmica O hormônio tireoidiano e seu receptor poderiam influenciar o processo inflamatório? Por que o hipotireoidismo aumenta o risco de doença cardiovascular?

9 Há outras condições que compartilham alterações do eixo HHT e alterações inflamatórias?

10 Síndrome do T3 baixo Função tireoidiana em doenças não tireoidianas – T3 – TSH normal ou baixo Correlação T3 e marcadores inflamatórios Association between serum interleukin-6 and serum 3,5,3-triiodothyronine in nonthyroidal illness. J Clin Endocrinol Metab 1993;77(6):1695–9. Relationship of the increased serum interleukin-6 concentration to changes of thyroid function in nonthyroidal illness. J Endocrinol Invest 1994;17:269–74. Role of cytokines in the pathogenesis of the euthyroid sick syndrome. Eur J Endocrinol 1998; 138:603–14. Relating circulating thyroid hormone concentrations to serum interleukins-6 and -10 in association with non-thyroidal illnesses including chronic renal insufficiency. BMC Endocr Disord 2008;8:1. Association between serum interleukin-6 and serum 3,5,3-triiodothyronine in nonthyroidal illness. J Clin Endocrinol Metab 1993;77(6):1695–9. Relationship of the increased serum interleukin-6 concentration to changes of thyroid function in nonthyroidal illness. J Endocrinol Invest 1994;17:269–74. Role of cytokines in the pathogenesis of the euthyroid sick syndrome. Eur J Endocrinol 1998; 138:603–14. Relating circulating thyroid hormone concentrations to serum interleukins-6 and -10 in association with non-thyroidal illnesses including chronic renal insufficiency. BMC Endocr Disord 2008;8:1.

11 Insuficiência cardíaca Correlação negativa T3 x IL-6, TNF- e proteína C reativa ControleT3L > 2T3L < 2 TNF (pg/mL) T3L (pg/mL) P < 0,05, r = -0,14 Relationship between triiodothyronine and proinammatory cytokines in chronic heart failure. Biomedicine & Pharmacotherapy 2010; 64:

12 Doença renal crônica Função tireoidiana na doença renal crônica – T3 – TSH normal, T3 reverso normal Correlação T3 x marcadores inflamatórios (IL-6, TFN-alfa)e sobrevida Clinical and biochemical implications of low thyroid hormone levels (total and free forms) in euthyroid patients with chronic kidney disease. J Intern Med 2007; 262:690–701. Low triiodothyronine: a new facet of inammation in end-stage renal disease. J Am Soc Nephrol 2005; 16: 2789–2795. Low triiodothyronine and survival in end-stage renal disease. Kidney Int 2006; 70:523–528. Subclinical hypothyroidism is linked to micro-inammation and predicts death in continuous ambulatory peritoneal dialysis. Nephrol Dial Transplant 2007; 22:538–544. Clinical and biochemical implications of low thyroid hormone levels (total and free forms) in euthyroid patients with chronic kidney disease. J Intern Med 2007; 262:690–701. Low triiodothyronine: a new facet of inammation in end-stage renal disease. J Am Soc Nephrol 2005; 16: 2789–2795. Low triiodothyronine and survival in end-stage renal disease. Kidney Int 2006; 70:523–528. Subclinical hypothyroidism is linked to micro-inammation and predicts death in continuous ambulatory peritoneal dialysis. Nephrol Dial Transplant 2007; 22:538–544.

13 Hormônio tireoidiano x inflamação T3 Inflamação Relação causa – efeito? Direcionalidade?

14 Receptores Nucleares O que são? – Uma superfamília 48 genes 75 proteínas – São complexos de sinalização que atuam de várias maneiras, modulando a ativação e a repressão de sinais.

15 Ligação ao DNA Ligante Transativação Ligação ao ligante A/BCDEF Domínio amino - terminal Dobradiça (Hinge) Domínio carboxi - terminal AF - 1DBDLBD

16 Histonas desacetiladas Histonas acetiladas Transcrição - T3 + T3 Mecanismo de ação do hormônio tireoidiano

17 Modelo de estudo Fator de necrose tumoral alfa (TNF- ) Macrófagos e monócitos Adipócitos, células mesangiais Receptor de membrana Inflamação sistêmica Indução de apoptose e inibição de tumorigênese Inibição da replicação viral Doenças humanas Resistência insulínica, síndrome metabólica, doença cardiovascular aterosclerótica

18 Objetivo Objetivo Geral: – Estudar o efeito do T3 e de seu receptor sobre a atividade transcricional no promotor do gene do TNF-α e esclarecer os mecanismos moleculares envolvidos na regulação desse gene. Objetivos Específicos: – Estudar o efeito do T3 na regulação da atividade transcricional do receptor do hormônio tireoidiano no promotor do gene do TNFα. – Estudar o efeito das diferentes isoformas de TR (TRα e TRβ). – Avaliar a importância da interação direta de TR com o promotor do TNFα. – Avaliar o efeito do T3 na síntese de proteína TNFα.

19 Construções de plasmídeos repórteres contendo promotor do TNF (inteiro ou fragmentos) -125 LUC -82 TNF RE LUC (-125/-82) 3X +93 LUC TK LUC

20 Receptor 1 mcg + (-1044)TNF-Luc 4 mcg vetor vazio TR alfa TR beta LBDTR beta T3 100 mM a a b b a a c a Taxa de ativação Células U937 TR e (-1044) TNF-Luc LUC

21 Transfecção O que é? – Introdução de moléculas exógenas em células – DNA plasmidial Em geral, a transfecção é seguida pela expressão de um ou mais genes presentes no DNA introduzido – Ensaio de gene repórter Métodos – Precipitação do fosfato de cálcio – Lipossomos – Eletroporação

22 Ensaio Gene Repórter Pra que serve o ensaio? – Para estudar a expressão dos genes – Avaliando o efeito de uma seqüência regulatória de um determinado gene O que podemos realizar com o ensaio? – Delimitar os elementos regulatórios – Avaliar os efeitos de agentes hormonais – Estudar impactos em mutações gênicas

23 Procedimento Processos: Lavagem (PBS 1x); Tripsina (0,5%); DMEN inibir a Tripsina Centrifugar: 5 min a 2000 rpm.

24 Procedimento Pellet: células Sobrenadante: meio de cultura 1.Suspensão das células em solução tampão (PBS, cálcio, glicose)

25 Mistura da suspensão de células ao DNA plasmidial Transferência da suspensão de células + DNA plasmidial para cuvetas de 0,4 cm Eletroporação DNA plasmidial TR TRE-luciferase L suspensão de células (10 x 10 6 células) 500 L /cuveta (10 x 10 6 células) 950 F e 0,3 kV

26 Ressuspensão das células eletroporadas em meio de cultura Distribuição da suspensão de células em placas de 12 poços e tratamentos 1 mL/poço Veículo T M T M T M

27 Avaliação da expressão do gene repórter 37 o C e 5% CO 2 24h 10 μL do lisado celular + 10 μL do substrato da enzima luciferase Luminômetro

28 LUC Células U-937

29 LUC Células U-937

30 -125 LUC -82 TNF RE LUC (-125/-82) 3X +93 LUC TK LUC

31 Células U LUC -82 TNF RE LUC (-125/-82) 3X +93 LUC TK LUC

32 O TR interage diretamente com o promotor do TNF- ? Ensaio de anisotropia de fluorescência wtTNFRE (CACTACCGCTTCCTCCAGATGAGCTCATGGGTTTCTCCACCAAG) wtTNFRE (CACTACCGCTTCCTCCAGATGAGCTCATGGGTTTCTCCACCAAG) DBD-TR +

33 Próximos passos… Ensaios de gene repórter com mutantes do TR – Papel da dimerização na repressão do promotor do TNF : L422R – Papel da superfície de interação com correpressores na repressão do promotor do TNF : G345R e F451X. Avaliação da expressão do TNF em resposta ao tratamento com T3 – Cultura de células: células mesangiais humanas Interação TR e promotor do TNF in vitro (gel shift) L422R (Mutante do TR beta – Leucina 422 trocada por uma Arginina) – diminuição da capacidade de dimerização G345R (Mutante no domínio de Ligação ao Ligante – LBD – Glicina 355 trocada por uma Arginina) – perda da afinidade do TR ao T3, não afetando ligação de dímeros ao TREs. F451X (Mutante TR beta – 10 ultimos aa apartir da Fenilalanina 451, foram deletados – Hélice 12 foi eliminado, superfície de ligação ao correpressor foi exposta. )

34 Obrigado!!!


Carregar ppt "Ação do hormônio tireoidiano e de seu receptor sobre o promotor do fator de necrose tumoral alfa Nome: Fellipe Erick Campos Orientadora: Angélica Amorin."

Apresentações semelhantes


Anúncios Google