A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Alinhamento de Sequências de Transcritos Gênicos Daniel Guariz Pinheiro, PhD. Laboratório de Genética Molecular e Bioinformática Departamento de Genética.

Apresentações semelhantes


Apresentação em tema: "Alinhamento de Sequências de Transcritos Gênicos Daniel Guariz Pinheiro, PhD. Laboratório de Genética Molecular e Bioinformática Departamento de Genética."— Transcrição da apresentação:

1 Alinhamento de Sequências de Transcritos Gênicos Daniel Guariz Pinheiro, PhD. Laboratório de Genética Molecular e Bioinformática Departamento de Genética Faculdade de Medicina de Ribeirão Preto Universidade de São Paulo

2 Planejamento Introdução Sequências – Formatos dos arquivos Alinhamento de Sequências Algoritmos para Alinhamento de Sequências Softwares para Alinhamento de Sequências no Genoma – Bowtie – BWA Software s auxiliares – Identificar as sequências intersectBED – Manipular saída de alinhamento (next-generation) samtools – Navegar no genoma Integrative Genomics Viewer - IGV Exercícios

3 Introdução Mapeamento genômico de transcritos – Alinhamento das sequências de cDNA obtidas de experimentos (e.g. RNA- Seq) no genoma referência; Identidade aceitável; – Desafio: qualidade das sequências e configuração dos parâmetros do software de alinhamento; Não ambígua (há uma única identidade); – Desafio: mapeamentos em regiões repetitivas; – Identificação das sequências alinhadas em relação a elementos já mapeados no genoma (e.g. transcritos conhecidos); Interseção entre coordenadas de alinhamento; – Desafio: configuração dos parâmetros para a interseção; Identificação de novas regiões com evidências de transcrição; – Agrupamento de sequências em uma região onde não há transcritos conhecidos; – Desafio: isolar o que é ruído, ou seja, artefatos da técnica; – Integrar essas informações; Relacionar informações de diversas fontes (e.g. expressão gênica, SNPs, regiões regulatórias, alternative splicing,...); Inspeção visual; Utilização de um browser de genoma (e.g. Genome Browser, GBrowse, Integrative Genomics Viewer (IGV), Gaggle Browser,... )

4 Sequências Genéticas

5 Sequence Read Archive (…) In mid-September 2010, the SRA contained >500 billion reads consisting of 60 trillion base pairs available for download (…) Almost 80% of the sequencing data are derived from the Illumina GA platform. The SOLiD and Roche/454 platforms account for 15% and 5% of submitted base pairs, respectively.(…) (Leinonen R et. al., 2011) Were growing by about 1 Tb/month. NCBIs staff scientist Martin Shumway International Nucleotide Sequence Database Collaboration SRA (NCBI Sequence Read Archive): ENA (EBI European Nucleotide Archive): DRA (DDBJ Sequence Read Archive):

6 Modelo de Dados [http://trace.ddbj.nig.ac.jp/dra/documentation_e.shtml]http://trace.ddbj.nig.ac.jp/dra/documentation_e.shtml

7 Formato Fasta >SEQUENCE_1 cagtcagcatactcagtcagtcatgcatgctga gtcacttgcatgacgtcatgactgcatgactgc sequence.fa Extensões:.fa,.fasta,.fna >SEQUENCE_ sequence.qual

8 Qualidade O que queremos dizer com qualidade ? >SEQUENCE_ ScoreP erro

9 Formato AGTACAAGAGACAGACATTCTTTTTTTTGACACAAG +SOLEXA01:1:1:27:1992#0/1 \FFFMXPYDDHJSUMVUJLPSNFRXZEDLNLHKHIT Identificador padrão Illumina sequence.fastq Extensões:.fastq Qualidade codificada como um único caracter da tabela ASCII. SOLEXA01 the unique instrument name 1 flowcell lane (8 lanes) 1 tile number within the flowcell lane 27 'x'-coordinate of the cluster within the tile 1992 'y'-coordinate of the cluster within the tile #0 index number for a multiplexed sample (0 for no indexing) /1 the member of a pair, /1 or /2 (paired-end or mate-pair reads only) F = 70 (ascii) = = 6 (Q phred ) = 0,25 (P error )

10 Color Space >9_62_1919_F3 T sequence.csfasta >9_62_1919_F3 TGATGGCGCATACGCCGTACACCGTGGGCGCCCCC sequence.fasta T0 = T => T1 = G => G2 = A =>...

11 sff sff refere-se a Standard Flowgram Format. Os arquivos gerados por uma corrida de Roche-454. Os arquivos sff contêm: – um cabeçalho manifesto, no início, o qual descreve informações sobre a corrida; – valores referentes às intensidades dos sinais para cada base; Formato binário (pirograma) que pode ser convertido para o formato FASTA; – Programa sffinfo.

12 Sequenciamento em pares – mate-pair – paired-ends (Korbel et al., 2007) > SOLEXA01:1:1:27:1992#0/1 > SOLEXA01:1:1:27:1992#0/2 Referência: ~ 128 bp a ~428 bp paired-ends 36 bp > SOLEXA02:1:1:11:1992#0/1 > SOLEXA02:1:1:11:1992#0/2 Referência: ~ 1928 bp a 4928 bp mate-pair 36 bp

13 Sequenciamento em pares (Illumina) Mate Pair Library Sequencing for Long Inserts paired-End Sequencing

14 ALINHAMENTO DE SEQUÊNCIAS Introdução

15 Alinhamento de Sequências Em Bioinformática, alinhamento de sequências é uma forma de dispor as sequências de DNA, RNA, ou proteínas para identificar regiões de similaridade que podem ser consequência de relacionamentos funcionais, estruturais ou relações evolutivas entre elas.

16 Significado Biológico do Alinhamento de Sequências Definição de 3 termos importantes: – identidade: refere-se à fração de aminoácidos ou nucleotídeos idênticos entre pares de sequências após um alinhamento dessas sequências; – similaridade: refere-se à fração de aminoácidos ou nucleotídeos similares (com propriedades físico-químicas semelhantes – aminoácidos conservados) entre pares de sequências após um alinhamento dessas sequências; – homologia: representa uma relação evolutiva entre as sequências; Homólogos – Parálogos; – Ortólogos;

17 Há uma referência? Resequenciamento – Existem sequências produzidas a partir de um genoma/transcriptoma da mesma espécie da amostra ou de uma espécie relacionada que podem ser usadas como referências. Alinhamento com a referência. Sequenciamento de novo – Não há sequências que podem ser usadas como referências. Este tipo de sequenciamento exigirá uma montagem (assembly) das sequências, utilizando apenas os dados obtidos desse sequenciamento. Alinhamento entre as sequencias geradas, que permitirá a obtenção de um consenso.

18 Identificação das sequências Resequenciamento – Alinhamento: Conjunto de Sequências X Sequências Referências (Ex.: Genoma) >seq1 gcagtcagtcacacatgtca... >seq2 cgcgcatgcGcgtactctat... >seq3 tcgagcatcatcagtcgtca... >seq4 tatgctttatagcgagtcat >chrX atcacacatgtcacatggtcag ggcatcagtcagtcagtcatgc gcgcgcatgcCcgtactctatc tcatgcgtcagtcatgcatgcg agcagtcatgcatgcatcgcac tgcatcatacgtcatgcatgaa..... Objetivos: - Eliminar as sequência sem hit - Eliminar as sequência com hits múltiplos (ambiguous) - Identificar as sequência com hit único (unambiguous)

19 Montagem de sequências Sequenciamento de novo – Alinhamentos: Conjunto de Sequências X Conjunto de Sequências (alinhamento pareado) Alinhamento Múltiplo de Sequências (MSA) ACAGTACGACAGTACGACCAGTACGATAGCAGTACGATACGACCGA TCCAGTACGATAGCAGTACGATCAG GCACAGTACGACCAGTACGATACAGGAAC CAGGTACGATACGACGGACGGGG ACAGTACGACAGTACGAAAC GTACGACCAGTACGATACACT AACGACAGTACGAAACGGG TATAGGTACGATACGACGGAC Consensus : Seq A Seq B Seq C Seq D Seq E Seq F Seq G

20 ALGORITMOS PARA ALINHAMENTO DE SEQUÊNCIAS Introdução

21 Problema básico Transformar uma sequência de caracteres em outra: – Operações: inserção deleção substituição – Custo de operação: Score de substituição Penalidade para Gaps (inserção/deleção) – Qual é a quantidade de operações mínima ? – Como achar a séries de operações que vai garantir que usamos a quantidade de operações mínima ? Exemplo: ACGT || G-GT Scores: Match: 2 Mismatch (S): -1 Gap(I): -2 Gap(D): -2 Score (4-2-1): 1 2 matches: 4 1 gap: -2 1 mismatch: -1

22 Soluções Matrix de pontos (dot matrix) – Informação qualitativa; Drosophila Dystrobrevin and Mouse ortholog [Goldstein e Gunawardenaa, 2000]

23 Soluções Matrix de pontos (dot matrix) – Informação qualitativa; Algoritmos de Programação Dinâmica – Smith-Waterman; Needleman-Wunsch; SW é um algoritmo para achar o alinhamento mais provável com uma estrutura certa;

24 Alinhamentos de Sequências Alinhamento Global (e.g. Algoritmo de Needleman-Wunsch) As sequências envolvidas devem ser alinhadas de um extremo ao outro. Adequado quando as sequências possuem aproximadamente o mesmo tamanho. T Seq X : C A T T A G C A G C C T | | | | | | G Seq Y : - A G T A – - A G C - - Alinhamento Local (e.g. Algoritmo de Smith–Waterman) Procura-se alinhar apenas as regiões mais similares, independente da localização relativa de cada região. Seq X [4,10]: T A G C A G C | | | | | Seq Y [3,7]: T A - - A G C Alinhamentos (Global/Local) (DNA/Protein) FASTA (http://fasta.bioch.virginia.edu/fasta_www2/fasta_list2.shtml)http://fasta.bioch.virginia.edu/fasta_www2/fasta_list2.shtml EMBOSS Align (http://www.ebi.ac.uk/Tools/emboss/align/)http://www.ebi.ac.uk/Tools/emboss/align/

25 Matriz de Programação Dinâmica Exemplo: ACGT || G-GT Scores: Match: 2 Mismatch (S): -1 Gap(I): -2 Gap(D): -2 Score (4-2-1): 1 2 matches: 4 1 gap: -2 1 mismatch: -1 D(i, j) = max D(i-1, j-1) + s(xi, yj) (diagonal -> match/mismatch) D(i -1, j) + g (acima -> gap acima) D(i, j -1) + g (esquerda -> gap esquerda) D(i-1,j-1)D(i-1,j) D(i,j-1)D(i,j) traceback GG A > Score (-2-1): -3 1 gap: -2 1 mismatch: -1 > Score(-1-2): -3 1 mismatch: -1 1 gap: -2 > Score(-4-2): -6 2 gaps: -4 1 gap: -2 GG A GG A

26 Solução Matrix de pontos (dot matrix) – Informação qualitativa; Algoritmos de Programação Dinâmica – Smith-Waterman; Needleman-Wunsch; SW é um algoritmo para achar o alinhamento mais provável com uma estrutura certa; Por razões de tempo e espaço, não pode ser usado para alinhamento de sequências de larga escala; Utilizações de aproximações (heurísticas); Geralmente, quanto mais rápida for a aproximação, mais distante estará a resposta da solução correta;

27 Desafios Eficiência; – velocidade; – sensibilidade; – especificidade; Ambiguidade causada por sequências repetitivas; Erros inerentes às técnicas de sequenciamento.

28 BLAST Basic Local Alignment Search Tool Heurística: dicionário de palavras (hash) – k-word – Constrói dicionário de palavras de cada k-mer da consulta (score threshold) e as procura nas referências por uma correspondência exata (match exato); E-value (S): número de diferentes alinhamentos com scores equivalentes ou melhores que S que são esperados ocorrer ao acaso em buscas em um banco de dados aleatório, do mesmo tamanho, com a mesma composição de bases; QUANTO MENOR... MELHOR!!! NÃO CONFUNDIR COM P-value (probabilidade)

29 BLAT BLATThe BLAST-Like Alignment Tool Estruturalmente diferente (BLAST) – Além de outros pontos, o Blat constrói o dicionário de palavras de tamanho k (k-mers) do banco de dado de sequências referências (database) e faz as buscas nas sequências as quais se deseja consultar (query); Blat é mais rápido, porém menos sensível; Possui código especialmente para lidar com intros em alinhamentos RNA/DNA; Comumente utilizado para localizar uma determinada sequência no genoma ou determinar a estrutura de exons de um RNA; Pode ser utilizado para alinhar sequências de Roche/454;

30 Alinhamento de sequências curtas BLAST/BLAT são lentos demais para alinhar milhões de sequências (Illumina: 35bp- 100bp/SOLiD: ) Considerações: – Não precisamos de um alinhamento sofisticado como SW; – Não precisamos de estatísticas com e-value; – Normalmente, sabemos a quantidade de mismatches máximas que queremos;

31 NEXT-GENERATION Introdução

32 Introdução à nova geração de algoritmos de alinhamento Alinhamentos: construção de índices (referências ou sequências) Dependendo da propriedade do índice. Os algoritmos podem ser classificados em 3 categorias: – Tabelas hash – Índices de sufixos/prefixos (Árvores/Arranjos) – merge-sorting slider (Malhis et al., 2009)

33 Implementações Alinhadores para leituras longas (>200bp): – BLAT, SSAHA2, BWA-SW, gsMapper. Alinhadores para leituras curtas: – Bfast, BioScope, Bowtie, BWA, CLC bio, CloudBurst, Eland/Eland2, GenomeMapper, GnuMap, Karma, MAQ, MOM, Mosaik, MrFAST/MrsFAST, NovoAlign, PASS, PerM, RazerS, RMAP, SSAHA2, Segemehl, SeqMap, SHRiMP, Slider/SliderII, SOAP/SOAP2, Srprism, Stampy, vmatch, ZOOM,...

34 Variação na Eficiência [Lunter et al., 2010]

35 Introdução à nova geração de algoritmos de alinhamento – Tabelas hash Paradigma: seed-and-extend – seed: correspondência (match) exata – tabela hash: índice (chave) é uma string (sequência k-mer) – chave: k-mer (k = 11 – BLAST default) – extensão (Smith Waterman – BLAST) – spaced-seed (match não consecutivo, baseado em um template ) » número de matches do seed é o seu peso (weight) Constrói Hash table das leituras e procura na referência – ELAND (Anthony. J. Cox, 2006, unpublished data) – MAQ (Li H et al., 2008) Constrói Hash table das referências e procura nas leituras – SOAP (Li R et al., 2008)

36 Alinhamentos baseados em Hashing table Idéia dos algoritmos de alinhamentos baseados em hashing tables com spaced-seeds: genoma: acggcacgaggaactcgaatctgacgcatgcagtacta | ||| || read: agtcgtat Se admitirmos 2 mismatches entre a minha sequência e o genoma. Se separados em 4 fragmentos, vão existir pelo menos 2 fragmentos sem mismatches, ou seja, com matches exatos !

37 spaced-seeds 6 possibilidades de seeds (templates), com no mínimo 2 fragmentos com match perfeito (ELAND) read: agtcgtat --tc--at --tcgt-- ag--gt-- ag----at ----gtat agtc

38 Hash Tables [Chen et al., 2009]

39 Alinhamento de Sequências com hashing Softwares – ELAND (Anthony. J. Cox, 2006, unpublished data), – MAQ (Li H et al., 2008) – SOAP (Li R et al., 2008) Características: – Para detectar sequências com mais mismatches, precisamos de mais seeds: Mais mismatches => mais tempo – Algoritmo mais sofisticado para o alinhamento vai requerer mais tempo: Indels/gaps => mais tempo Problemas com hashing: – Memória e tempo Precisa de múltiplos processadores e muita memória. – Necessidade de métodos menos glutões

40 Introdução à nova geração de algoritmos de alinhamento – Índices de sufixos/prefixos (Árvores/Arranjos) Estrutura de dados que permite a representação de todos os sufixos/prefixos de um determinada string S. Possibilitando encontrar as ocorrências de um determinado padrão (sequência); Alinhamento: encontrar os matches exatos no índice, utilizando representações: – Árvore de sufixos (Suffix tree) – Arranjo de sufixos (Suffix array) » Índice-FM (FM-index) (Ferragina and Manzini, 2000) – BWT Alinhadores de sequências: Bowtie (Langmead et al., 2009) BWA BWA-SHORT (Li and Durbin, 2009) BWA-SW (Li and Durbin, 2010)

41 Árvore de sufixos String indexada: ^GOOGOL$ String procurada: LOL Mismatches permitidos: 1 Match: GOL [Li and Durbin, 2009]

42 Transformação de Burrows–Wheeler FM-Index (Ferragina e Manzini, 2000); – Burrows-Wheeler Transform (BWT) Algoritmo usado normalmente em softwares de compressão (.bzip2); Ideia básica: dada uma sequência S de n símbolos, reordenar os símbolos formando outra sequência L, que verifica duas condições: – a probabilidade de um símbolo ser igual ao anterior é muito elevada; – é possível reconstruir S a partir de L e de mais alguma informação (primary index); Transformation T => BWT(T) Input All Rotations Sort the Rows @^BANANA Inverse Transformation BWT(T) => T Input Add 1Sort 1Add 2Sort 2 BA NA ^B AN BA NA Add 3Sort 3Add 4Sort 4 BAN NAN ^BA ANA BAN NAN BANA NANA ^BAN ANAN BANA NANA Add 5Sort 5Add 6Sort 6 BANAN ^BANA ANANA BANAN BANANA ^BANAN @^BANA BANANA Add 7Sort 7Add 8Sort 8 ^BANANA @^BANAN @^BANANA @^BANANA Output

43 FM-Index [Li and Durbin, 2009] Array de sufixos Transformação de Burrows Wheeler Sequência Rotações

44 LF mapping A ordem de ocorrência de um caracter na última coluna é a mesma ordem de ocorrência na primeira coluna. (a)T => BWT(T) (b)BWT(T) => T (c)Exact Match ponteiros Suffix Array Quando dois ponteiros se encontram: match [Langmead et al., 2009] BWT Reconstrução da sequência original Match exato (aac)

45 Inexact Matching Backtracks [Langmead et al., 2009] depth-first-traversal Bowtie

46 BWA-SW Heurísticas + Smith-Waterman-like Apropriado para sequências longas (> 100 pb) – Mais acurado e ~10 vezes mais rápido que o BLAT A - Árvore de sufixos GOOGOL; B – Grafo Direcionado Acíclico de Palavras (DAWG) GOOGOL; Sequência da leitura (query) Sequência Referência (reference) representação implícita Percorre as duas estruturas de índices de sufixos (para a leitura e para a referência) alinhando- as utilizando programação dinâmica; Utiliza heurísticas para não percorrer toda a estrutura (Z-best strategy), identificando seeds de alinhamento com o maior score; Utiliza o algoritmo de Smith-Waterman para extender o alinhamento das seeds identificadas;

47 Bowtie – Burrows-Wheeler; Reduz a quantidade de memória e de tempo para alinhar sequências curtas; Podem ser usadas sequências Illumina e SOLiD – Deficiências: Não tem garantia de retornar todos os hits com mismatches (exceto com opção --best) Limite de 3 mismatches (demora mais) Reads longos reduz a velocidade Não permite alinhamento com gaps

48 Bowtie Index Builder: bowtie-build Usage: bowtie-build [options]* reference_in comma-separated list of files with ref sequences ebwt_outfile_base write Ebwt data to files with this dir/basename Options: -f reference files are Fasta (default) -c reference sequences given on cmd line (as ) -C/--color build a colorspace index -a/--noauto disable automatic -p/--bmax/--dcv memory-fitting -p/--packed use packed strings internally; slower, uses less mem -B build both letter- and colorspace indexes --bmax max bucket sz for blockwise suffix-array builder --bmaxdivn max bucket sz as divisor of ref len (default: 4) --dcv diff-cover period for blockwise (default: 1024) --nodc disable diff-cover (algorithm becomes quadratic) -r/--noref don't build.3/.4.ebwt (packed reference) portion -3/--justref just build.3/.4.ebwt (packed reference) portion -o/--offrate SA is sampled every 2^offRate BWT chars (default: 5) -t/--ftabchars # of chars consumed in initial lookup (default: 10) --ntoa convert Ns in reference to As --seed seed for random number generator -q/--quiet verbose output (for debugging) -h/--help print detailed description of tool and its options --usage print this usage message --version print version information and quit [/data/indexes]$ bowtie-build /data/hg18.fa hg18 $BOWTIE_INDEXES=/data/indexes hg18.1.ebwt hg18.2.ebwt hg18.3.ebwt hg18.4.ebwt hg18.rev.1.ebwt hg18.rev.2.ebwt

49 Bowtie Index Inspector: bowtie-inspect Usage: bowtie-inspect [options]* ebwt filename minus trailing.1.ebwt/.2.ebwt By default, prints FASTA records of the indexed nucleotide sequences to standard out. With -n, just prints names. With -s, just prints a summary of the index parameters and sequences. With -e, preserves colors if applicable. Options: -a/--across Number of characters across in FASTA output (default: 60) -n/--names Print reference sequence names only -s/--summary Print summary incl. ref names, lengths, index properties -e/--ebwt-ref Reconstruct reference from ebwt (slow, preserves colors) -v/--verbose Verbose output (for debugging) -h/--help print detailed description of tool and its options --help print this usage message [/data/indexes]$ bowtie-inspect -s hg18

50 Bowtie Aligner: bowtie Reporting: -k report up to good alignments per read (default: 1) -a/--all report all alignments per read (much slower than low -k) -m suppress all alignments if > exist (def: no limit) -M like -m, but reports 1 random hit (MAPQ=0); requires --best --best hits guaranteed best stratum; ties broken by quality --strata hits in sub-optimal strata aren't reported (requires --best) Output: -t/--time print wall-clock time taken by search phases -B/--offbase leftmost ref offset = in bowtie output (default: 0) --quiet print nothing but the alignments --refout write alignments to files refXXXXX.map, 1 map per reference --refidx refer to ref. seqs by 0-based index rather than name --al write aligned reads/pairs to file(s) --un write unaligned reads/pairs to file(s) --max write reads/pairs over -m limit to file(s) --suppress suppresses given columns (comma-delim'ed) in default output --fullref write entire ref name (default: only up to 1st space) Colorspace: --snpphred Phred penalty for SNP when decoding colorspace (def: 30) or --snpfrac approx. fraction of SNP bases (e.g ); sets --snpphred --col-cseq print aligned colorspace seqs as colors, not decoded bases --col-cqual print original colorspace quals, not decoded quals --col-keepends keep nucleotides at extreme ends of decoded alignment SAM: -S/--sam write hits in SAM format --mapq default mapping quality (MAPQ) to print for SAM alignments --sam-nohead supppress header lines (starting for SAM output --sam-nosq header lines for SAM output --sam-RG add (usually "lab=value") line of SAM header Performance: -o/--offrate override offrate of index; must be >= index's offrate -p/--threads number of alignment threads to launch (default: 1) --mm use memory-mapped I/O for index; many 'bowtie's can share --shmem use shared mem for index; many 'bowtie's can share Other: --seed seed for random number generator --verbose verbose output (for debugging) --version print version information and quit -h/--help print this usage message Usage: bowtie [options]* {-1 -2 | --12 | } [ ] Comma-separated list of files containing upstream mates (or the sequences themselves, if -c is set) paired with mates in Comma-separated list of files containing downstream mates (or the sequences themselves if -c is set) paired with mates in Comma-separated list of files containing Crossbow-style reads. Can be a mixture of paired and unpaired. Specify "-" for stdin. Comma-separated list of files containing unpaired reads, or the sequences themselves, if -c is set. Specify "-" for stdin. File to write hits to (default: stdout) Input: -q query input files are FASTQ.fq/.fastq (default) -f query input files are (multi-)FASTA.fa/.mfa -r query input files are raw one-sequence-per-line -c query sequences given on cmd line (as, ) -C reads and index are in colorspace -Q/--quals QV file(s) corresponding to CSFASTA inputs; use with -f -C --Q1/--Q2 same as -Q, but for mate files 1 and 2 respectively -s/--skip skip the first reads/pairs in the input -u/--qupto stop after first reads/pairs (excl. skipped reads) -5/--trim5 trim bases from 5' (left) end of reads -3/--trim3 trim bases from 3' (right) end of reads --phred33-quals input quals are Phred+33 (default) --phred64-quals input quals are Phred+64 (same as --solexa1.3-quals) --solexa-quals input quals are from GA Pipeline ver. = integer-quals qualities are given as space-separated integers (not ASCII) Alignment: -v report end-to-end hits w/ max mismatches in seed (can be 0-3, default: -n 2) -e/--maqerr max sum of mismatch quals across alignment for -n (def: 70) -l/--seedlen seed length for -n (default: 28) --nomaqround disable Maq-like quality rounding for -n (nearest 10 minimum insert size for paired-end alignment (default: 0) -X/--maxins maximum insert size for paired-end alignment (default: 250) --fr/--rf/--ff -1, -2 mates align fw/rev, rev/fw, fw/fw (default: --fr) --nofw/--norc do not align to forward/reverse-complement reference strand --maxbts max # backtracks for -n 2/3 (default: 125, 800 for --best) --pairtries max # attempts to find mate for anchor hit (default: 100) -y/--tryhard try hard to find valid alignments, at the expense of speed --chunkmbs max megabytes of RAM for best-first search frames (def: 64) [/data]$ bowtie hg18 \ > -c "AGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTT,AGGGCCCATAGCAACAGATTTCTAGCCCCCTGAAGA" > --best --strata --tryhard -m 1

51 Principais parâmetros do Bowtie Alignment: -n : número máximo de mismatches na seed [1..3] (2) – Mutuamente exclusivo (-v); -v : número máximo de mismatches em todo o alinhamento, ignorando qualidade; -l : tamanho da seed [5..*] (28); -e : total valor qualidade [10..30] máximo para as posições onde há mismatch, considerando o alinhamento todo (70); --maxbts : número máximo de backtracks permitidos (125, 800 com --best); --pairtries : número máximo de tentativas de encontrar sequências em pares; --try_hard: equivalente p/ valores altos de --maxbts e –pairtries Reporting: --best: reporta os melhores alinhamentos considerando número de mismatches na seed e o valor de qualidade dessas bases; (1 mismatch qual 40 é melhor que 2 mismatches qual 10) -a: reporta todos os alinhamentos válidos; -k : reporta até k alinhamentos válidos; -m : suprime os alinhamentos múltiplos de uma leitura se há mais que m alinhamentos válidos;

52 BWA Dois algoritmos baseados na Transformação de Burrows-Wheeler (BWT) – sequências pequenas (queries) até ~200bp com baixa taxa de erro (<3%) Alinhamento global (FM-index) com respeito às queries, suporta sequências paired-ends. BWA (Li and Durbin, 2009) – sequências longas (queries) com taxa de erro maior Alinhamento local = heurísticas+Smith-Waterman-like em árvores de sufixos, não suporta sequências paired-ends. Lento para sequências pequenas. BWA-SW (Li and Durbin, 2010)

53 BWA (index) bwa index [-p prefix] [-a algoType] [-c] Index database sequences in the FASTA format. Constrói os índices das sequências de referência que serão utilizadas no alinhamento. OPTIONS: -c Build color-space index. The input fast should be in nucleotide space. -p STR Prefix of the output database [same as db filename] -a STR Algorithm for constructing BWT index. Available options are: is IS linear-time algorithm for constructing suffix array. - requires 5.37*N (N = size of the database) - IS is moderately fast, but does not work with database larger than 2GB. bwtsw Algorithm implemented in BWT-SW. - does not work with database smaller than 10MB and it is usually slower than IS. [/data/indexes]$ bwa index –a bwtsw /data/hg19.fa

54 BWA (aln) bwa aln [-n maxDiff] [-o maxGapO] [-e maxGapE] [-d nDelTail] [-i nIndelEnd] [-k maxSeedDiff] [-l seedLen] [-t nThrds] [-cRN] [-M misMsc] [-O gapOsc] [-E gapEsc] [-q trimQual] [-f ] Encontra as coordenadas das leituras no array de sufixos; MAIN OPTIONS: -IThe input is in the Illumina 1.3+ read format; -n NUM Maximum edit distance (maxDiff). Máximo de diferenças permitidas no alinhamento todo. Se inteiro é a distância de edição, se ponto flutuante, automaticamente seleciona essa distância de edição com base nos valores de taxa de erro (uniforme) 2%, tamanho das sequências e NUM (threshold) [0.04]; -l INT Take the first INT subsequence as seed (seedLen) – Tamanho da primeira semente de alinhamento. Se INT maior que o tamanho das sequências, desabilita seeding [32]; -k INTMaximum edit distance in the seed (maxSeedDiff) – Número máximo de diferenças permitidas na primeira semente de alinhamento (seed) [2]; -t INTNumber of threads (multi-threading mode) [1]; -o INTMaximum number of gap opens [1] -e INT Maximum number of gap extensions, -1 for k-difference mode (disallowing long gaps) [-1] -d INT Disallow a long deletion within INT bp towards the 3-end [16] -i INT Disallow an indel within INT bp towards the ends [5] -N Disable iterative search. All hits with no more than maxDiff differences will be found. This mode is much slower than the default. -q INT Parameter for read trimming (soft clipping). [/data/input]$ bwa aln –f out.sai /data/hg19.fa in.fastq

55 BWA (samse/sampe) bwa samse [-n maxOcc] –f Gera alinhamentos no formato SAM a partir de leituras single-end. Hits repetitivos são escolhidos aleatoriamente. bwa sampe [-a maxInsSize] [-o maxOcc] [-n maxHitPaired] [-N maxHitDis] [-P] -f Gera alinhamentos no formato SAM a partir de leituras paired-end. Hits de pares repetitivos são escolhidos aleatoriamente. MAIN OPTIONS: -n INT Maximum number of alignments to output in the XA tag for reads paired properly. If a read has more than INT hits, the XA tag will not be written. [3] -N INTMaximum number of alignments to output in the XA tag for disconcordant read pairs (excluding singletons). If a read has more than INT hits, the XA tag will not be written. [10] -sDisable Smith-Waterman for the unmapped mate; [/data/input]$ bwa samse –f out.sam /data/hg19.fa out.sai in.fastq [/data/input]$ bwa sampe –f outpe.sam /data/hg19.fa out1.sai out2.sai \ > in1.fastq in2.fastq

56 BWA (bwasw) bwa bwasw [-a matchScore] [-b mmPen] [-q gapOpenPen] [-r gapExtPen] [-t nThreads] [-w bandWidth] [-T thres] [-s hspIntv] [-z zBest] [-N nHspRev] [-c thresCoef] –f Gera alinhamento de sequências longas no formato SAM. MAIN OPTIONS: -t INT Number of threads in the multi-threading mode [1] -z INT Z-best heuristics. Higher -z increases accuracy at the cost of speed. [1] -s INTMaximum SA interval size for initiating a seed. Higher -s increases accuracy at the cost of speed. [3] [/data/input]$ bwa bwasw –f out.sam /data/hg19.fa in.fastq

57 The Sequence Alignment Map Formato genérico para armazenar o resultado dos alinhamentos de sequências de leituras contra sequências de referência; – (Li et al., 2009) Suporta o armazenamento de dados das mais variadas plataformas de sequenciamento; – Há duas seções: cabeçalho (iniciadas corpo (alinhamentos); – O alinhamento é representado no corpo por linhas com campos (11 mandatórios) delimitados por TAB;

58 Formato SAM (1)

59 Mapping Quality Qualidade do mapeamento – escala Phred de qualidade (Li et al., 2008);

60 Formato SAM (2) C pile-up SAM forward match (.) mismatch (base in lower case) reverse match (,) mismatch (base in upper case) insertion + deletion - missing * start read alignent ^ end read alignment $

61 Bitwise FLAG Exemplo: FLAG 2 alinhamentos de leituras paired-end FLAGs: 99 ( ) 147 ( )

62 Formato BED Formato flexível para definição de dados de anotação. Os três primerio campos são requeridos: chrom – Nome do cromossomo chromStart – Início da coordenada no cromossomo chromEnd – Final da coordenada no cromossomo name – Nome da linha de anotação score – Pontuação entre 0 e 1000 strand – Fita do DNA + ou - thickStart – Início da coordenada de destaque (por ex. start codon) thickEnd – Fim da coordenada de destaque (por ex. stop codon) itemRgb – Valor RGB no formato R,G,B (e.g. 255,0,0) ; cor no Genome Browser blockCount – Número de blocos de alinhamento (por ex. exons) blockSizes – Lista (separada por vírgula) de tamanho dos blocos blockStarts – Lista (separada por vírgula) com o iníco da coordenada dos blocos Exemplo chr NR_ ,205,361,0,666,1110, chr NR_ ,1044,57,0,6041,8675,

63 BEDtools Conjunto de utilitários que permitem executar tarefas comuns em genômica, tais como encontrar coordenadas de alinhamentos que possuem sobreposição; Funcionalidades – bamToBed Converte alinhamentos no formato BAM para o formato BED – intersectBedRetorna as sobreposições entre dois arquivos no formato BED –...

64 samtools Provê várias ferramentas para manipulação dos alinhamentos no formato SAM/BAM Funcionalidades – importConversão de SAM-para-BAM – viewConversão de BAM-para-SAM e recuperação de subalinhamentos – sortOrdenação (posição nos cromossomos) – mergeunião de múltiplos alinhamentos ordenados – indexIndexação de alinhamentos ordenados – faidxIndexação de arquivos FASTA e recuperação de subsequências – tviewVisualização do alinhamento – pileupGera arquivo de cobertura por posição

65 goby Sistema computacional para manipulação de dados da nova geração de sequenciamento, com aplicações que facilitam a implementação de pipelines de análise de dados; Funcionalidades – Filtragem de leituras redunantes; – Criação de arquivos nos formatos wiggle/bed para visualização; – Análise de expressão gênica diferencial; – Detecção de variações; – …

66 Integrative Genomics Viewer IGV (Genome Browser) – – Download – ~10Mb (.zip) – Permissão execução p/ todos – chmod a+x igv_linux.sh – Aumentar espaço de alocação de memória – Editar arquivo igv_linux.sh (-Xmx1200m) – Necessita acesso à internet!

67 Referências Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res Apr;38(6): Epub 2009 Dec 16. Review. PubMed PMID: ; PubMed Central PMCID: PMC ; Li H, Homer N. A survey of sequence alignment algorithms for next-generation sequencing. Brief Bioinform Sep;11(5): Epub 2010 May 11. Review. PubMed PMID: ; PubMed Central PMCID: PMC ; Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics Jul 15;25(14): Epub 2009 May 18. PubMed PMID: ; PubMed Central PMCID: PMC ; Li H, Durbin R. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics Mar 1;26(5): Epub 2010 Jan 15. PubMed PMID: ; PubMed Central PMCID: PMC ; Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10(3):R25. Epub 2009 Mar 4. PubMed PMID: ; PubMed Central PMCID: PMC ; Li H, Ruan J, Durbin R. Mapping short DNA sequencing reads and calling variants using mapping quality scores. Genome Res Nov;18(11): Epub 2008 Aug 19. PubMed PMID: ; PubMed Central PMCID: PMC ; Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. Integrative genomics viewer. Nat Biotechnol Jan;29(1):24-6. PubMed PMID: ; Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R; 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics Aug 15;25(16): Epub 2009 Jun 8. PubMed PMID: ; PubMed Central PMCID: PMC ;

68 Daniel Guariz Pinheiro


Carregar ppt "Alinhamento de Sequências de Transcritos Gênicos Daniel Guariz Pinheiro, PhD. Laboratório de Genética Molecular e Bioinformática Departamento de Genética."

Apresentações semelhantes


Anúncios Google