A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Introdução à Bioinformática Prof. Bioinformática União da ciência da computação com a biologia molecular É uma área nova Há 10 anos atrás o termo.

Apresentações semelhantes


Apresentação em tema: "Introdução à Bioinformática Prof. Bioinformática União da ciência da computação com a biologia molecular É uma área nova Há 10 anos atrás o termo."— Transcrição da apresentação:

1 Introdução à Bioinformática Prof.

2 Bioinformática União da ciência da computação com a biologia molecular É uma área nova Há 10 anos atrás o termo nem existia Depois da descoberta de Watson e Crick (1953) de que o DNA é estruturado como uma hélice dupla; a Bioinformática passa a ser um dos instrumentos mais importante e fundamental para o estudo da Biologia Molecular.

3 A história começa na década de 1940 com a invenção do moderno computador digital Ele se chama digital, pois os dados são armazenados com um alfabeto binário Dígitos binários – 0 e 1 A operação também é digital, baseada na lógica liga/desliga A descoberta da hélice dupla, em 1953, mostrou que a informação genética também é armazenada de forma digital Mas diferente do alfabeto binário dos computadores, os dados genéticos são armazenados com um alfabeto quaternário A, C, G e T Mais tarde se descobriu que a forma dos genes operarem também é digital Até certo ponto, os genes podem ser ligados ou desligados Apenas estas observações já seria suficiente para prever, na década de 1950, que um dia informática e biologia molecular iriam juntas fazer nascer uma nova área de conhecimento

4 A bioinformática passou a ser reconhecida como importante pelo mundo científico por volta de 1995 Ano que o primeiro genoma de uma bactéria foi publicado A Biologia Molecular Apesar da estrutura do DNA ter sido desvendada em 1953, a informação nela contida não podia ser lida Foi como tivéssemos descoberto o alfabeto utilizado para escrever o livro da vida, mas as palavras desse livro estavam com letrinhas tão pequenas que não conseguíamos lê-las Foi preciso esperar até fins da década de 1980 para que aparecesse uma lente de aumento suficientemente boa que permitisse a leitura dessas letrinhas em grande quantidade A computação Computadores sendo capazes de armazenar cada vez mais informação, de processá-la de modo cada vez mais rápido, a um custo cada vez menor Na década de 1970 a unidade básica de armazenamento de informação era o kilobyte bytes, aproximadamente 1000 letras Um computador de grande porte daquela época tinha alguns kbytes de memória Com tal memória um computador desses não seria capaz de processar nem sequer o genoma de um vírus, que pode chegar a 20 kilobases, ou 20 mil letrinhas; que dirá o genoma humano, com seus 3 bilhões de letrinhas Quase que em sintonia desembocamos em 1995 Os computadores já estavam suficientemente poderosos para poder processar os milhões e milhões de letrinhas. E assim nasceu a bioinformática,

5 Primeiro _ problema é chamado de problema biotecnológico Montagem do DNA Segunda _ diz respeito à natureza da biologia molecular Saber que informação está contida nos genomas

6 Montagem de DNA Um genoma de bactéria tem em geral 3 ou 4 milhões de letrinhas ou bases As máquinas seqüenciadoras conseguem ler apenas pedaços de cerca de 1000 bases Então como é possível ler um livro de 3 ou 4 milhões de letras se só conseguimos ler fragmentos de 1000 letras? A solução é gerar uma enorme quantidade de fragmentos que tenham sobreposição entre si Para ler 3 ou 4 milhões são necessários cerca de 100 mil desses fragmentos É necessário um programa de computador para montar esse quebra cabeça Montagem de DNA É necessario um computador que consiga ler diretamente as 3 ou 4 milhões de bases Existem dezenas ou centenas de outros problemas na bioinformática, cada um deles motivado por uma particular tecnologia Limitação tecnológica atual

7 Que problemas são esses? São basicamente de dois tipos Primeiro- temos a interpretação do DNA como uma linguagem, a linguagem dos genes Segundo- entender os efeitos da informação genética Os genomas contém informação Por exemplo: Para diferentes espécies de organismos e para diferentes indivíduos de uma espécie, particularmente a nossa. Essa interpretação requer métodos, técnicas, algoritmos que vêm principalmente da informática, pois afinal ela é a ciência da informação Dar sentido a essa sopa é tarefa dos bioinformatas

8 Algumas Definições Pesquisa e desenvolvimento de ferramentas computacionais, matemáticas e estatísticas para a resolução de problemas da Biologia Biologia Molecular Número de definições Número de bioinformatas Muitos tem sua própria definição de Bioinformática, com detalhes sutis para refletir seu interesse em Ciências Biológicas A Computação está para a Biologia da mesma forma que a matemática está para física Harold Morowitz A Computação está para a Biologia da mesma forma que a matemática está para física Harold Morowitz Uma combinação de Ciência da Computação, Tecnologia da Informação e Genética para determinar e analisar informação genética Bits Journal - Bioinformatics: Information Technology & Systems Uma combinação de Ciência da Computação, Tecnologia da Informação e Genética para determinar e analisar informação genética Bits Journal - Bioinformatics: Information Technology & Systems

9 Ênfase está se deslocando progressivamente do acúmulo de dados para a sua interpretação Com os sequenciamentos realizados, um grande volume de dados tem sido gerado Esses dados precisam agora ser analisados Análise laboratorial é difícil e cara Ferramentas computacionais sofisticadas são necessárias para a análise dos dados obtidos

10 Para muitas dessas análises, as ferramentas computacionais precisam lidar com dados imprecisos e ruidosos Técnicas de laboratório de Biologia Molecular quase sempre geram dados com erros ou imprecisões Erros na coleta de dados Erros na construção de bases de dados Fornece técnicas para lidar com os problemas acima Aprendizado de Máquina

11

12 TAGAGCATCGATCGATGCTGCAGATGATGCTAGCATCGGCTAGGCGACG ATCTCGTAGCTA ATCTCGTAGCTAGCTACGACGTCTA ATCTCGTAGCTAGCTA ATCTCGTAGCTAG ATCTCGTAGCTAGC ATCTCGTAGCTAGCT ATCTCGTAGCTAGCTAC ATCTCGTAGCTAGCTACG ATCTCGTAGCTAGCTACGA ATCTCGTAGCTAGCTACGAC ATCTCGTAGCTAGCTACGACG ATCTCGTAGCTAGCTACGACGT ATCTCGTAGCTAGCTACGACGTC ATCTCGTAGCTAGCTACGACGTCT eletroforese capilar e leitura da fluorescência da unidade interruptora ATCTCGTAGCT

13 15 milhões Europeu Japonês

14


Carregar ppt "Introdução à Bioinformática Prof. Bioinformática União da ciência da computação com a biologia molecular É uma área nova Há 10 anos atrás o termo."

Apresentações semelhantes


Anúncios Google