A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Identificação computacional de genes de microRNA Alexandre dos Santos Cristino Bruno Augusto N. Travençolo César Beltrán Castañón Elza Helena Andrade Barbosa.

Apresentações semelhantes


Apresentação em tema: "Identificação computacional de genes de microRNA Alexandre dos Santos Cristino Bruno Augusto N. Travençolo César Beltrán Castañón Elza Helena Andrade Barbosa."— Transcrição da apresentação:

1 Identificação computacional de genes de microRNA Alexandre dos Santos Cristino Bruno Augusto N. Travençolo César Beltrán Castañón Elza Helena Andrade Barbosa

2 Roteiro Introdução Caracterização biológica de miRNAs Predição computacional de miRNA de Drosophila Validação experimental dos candidatos à miRNA Conclusões

3 Introdução rRNA miRNA Interrupção

4 Introdução RNA mRNA ncRNA Non-coding RNA. RNA transcrito tem papel estrutural, funcional ou catalítico rRNA Ribosomal RNA Participa da síntese de proteínas tRNA Transfer RNA Interface entre RNAm e aminoácidos snRNA Small nuclear RNA RNA que fazem parte do spliceossomo snoRNA Small nucleolar RNA Encontrado no nucléolo e esta envolvido na modificação do RNAr miRNA Micro RNA Pequenos fragmentos de RNA que estão envolvidos na regulação da expressão gênica siRNA Small interfering RNA ativa moléculas na interferência por RNA stRNA Small temporal RNA. RNA com função de regulação do desenvolvimento biológico Outros RNAs maiores compondo a estrutura da cromatina e relacionados ao imprinting

5 Caracterização biológica de miRNAs O que é um microRNA (miRNA)? Nova classe de pequenos RNAs reguladores, escondidos no genoma (regiões intergênica e intrônica ou DNA lixo) Estes miRNA de 22 nucleotídeos foram descobertos em estudos de regulação do desenvolvimento de C. elegans (lin-4 e let-7) Alguns com expressão constitutiva, e outros com controle de expressão temporal- e tecido-específica

6 Caracterização biológica de miRNAs Inicialmente transcrito como um pré-miRNA de pb (stem loop, hairpin, double strand) Pré-miRNA é processado pela Dicer (RNAase III) Formação de miRNA maduro com nt Atua negativamente na regulação pós- transcricional pela formação de um duplex RNA, interrompendo a tradução de um RNAm pela região 3-UTR RNAi -> silenciamento gênico

7 Caracterização biológica de miRNAs LoopmiRNA Dicer (RNAase III) UGAGGUAGUAGGUUGUAUAGU (miRNA)

8 Caracterização biológica de miRNAs miRNA são altamente conservados em grupos filogenéticos afastados (insetos, peixe e humano)

9 Predição computacional de miRNA de Drosophila Regras e parâmetros foram derivados a partir de 24 sequências de miRNA de Drosophila O alinhamento global (VISTA) entre os genomas de espécies diferentes de Drosophila mostraram alta conservação nas 24 sequências de miRNA referência.

10 Predição computacional de miRNA de Drosophila Alinhamento global D. melanogaster e D. pseudoobscura (VISTA plot)

11 Predição computacional de miRNA de Drosophila O alto grau de conservação e a formação de stem-loop não são características exclusivas dos miRNAs Portanto, foram necessários critérios adicionais, tais como determinar padrões de divergência dos nucleotídeos entre os 24 pares ortólogos

12 Predição computacional de miRNA de Drosophila Resultado do Alinhamento Conservação total (3/24) diverge no loop (10/24) Divergência no loop divergência em um braço (10/24) Divergência nos braços (0/24) Divergência em um braço (0/24) Divergência no braço >> divergência no loop (1/24)

13 Predição computacional de miRNA de Drosophila Observações do conjunto referência (24 miRNA) indicam que os miRNAs são filogeneticamente conservados e a estrutura stem-loop demostra um padrão característico de divervêngia dos nucleotídeos. miRseeker: pipeline desenvolvido para localizar candidatos a miRNA no genoma Dividido em três partes: 1. Identificar regiões conservadas; 2. Identificar e avaliação da qualidade de stem-loops; 3. Avaliar padrões de divergência

14 Predição computacional de miRNA de Drosophila 1. Identificar regiões conservadas

15 Predição computacional de miRNA de Drosophila 1. Identificar regiões conservadas - AVID D. Melanogaster 1287 contigs D. Pseudoobscura contigs AVID – Alinhamento Global Eliminar os genes anotados, tais como: exons, transpossons, snRNA, snoRNA, tRNA, rRNA Alinhamento total resultou em 51.3 de 90.2 MB de sequências intrônicas e intergênicas

16 Predição computacional de miRNA de Drosophila 1. Identificar regiões conservadas Sem sobreposição e cruzamento Prefere clean matches à repeated matches Tamanhos maiores que a metade do maior match Score baseado no tamanho e nos vizinhos

17 Predição computacional de miRNA de Drosophila 1. Identificar regiões conservadas D. Melanogaster 1287 contigs D. Pseudoobscura contigs AVID – Alinhamento Global Eliminar os genes anotados, tais como: exons, transpossons, snRNA, snoRNA, tRNA, rRNA Alinhamento total resultou em 51.3 de 90.2 MB de sequências intrônicas e intergênicas

18 Predição computacional de miRNA de Drosophila 1. Identificar regiões conservadas Determinar uma região candidata a miRNA Janela de 100 unidades (pares de nucleotídeos alinhados ou gap) avança no alinhamento critério mínimo de conservação: 13% gaps e 15% mismatchs critério satisfeifo -> sequência Dm/Dp guardada em arquivo multi-fasta -> janela avança 10 unidades regiões conservadas em sequências intrônicas e intergênica super-regiões (agrupamento de regiões que apresetaram sobreposição de 10 nt)

19 Predição computacional de miRNA de Drosophila 2. Identificar e avaliar qualidade de stem-loops

20 Análise de regiões conservadas com o algoritmo de dobramento de RNA (folding), mfold 3.1 miRNA pode estar localizado em qualquer uma das fitas (forward e reverse), o pode interferir na qualidade do hairpin predito x2 = mfolds cutoff -> mínimo de 23 pares de bases e energia livre de um braço G kcal/mol

21 Predição computacional de miRNA de Drosophila 2. Identificar e avaliar qualidade de stem-loops Métricas para o helical score: Premia nucleotídeos pareados em +1 Penaliza cada loop simétricos de um nucleotídeo em –1 Penaliza cada loop simétrico de dois nucleotídeos em –2 Penaliza progressivamente loops simétricos com mais de três nucleotídeos, assim como bulbos e loops assimétricos Maximiza o tamanho de stem e minimiza o loop Um score total foi calculado pela fórmula: (helical score +(ABS( G)/2))/2

22 Predição computacional de miRNA de Drosophila 2. Identificar e avaliar qualidade de stem-loops melhores super-regiões Dm regiões com maior score de cada super-região D. Melanogaster (Dm) D. Pseudoobscura (Dp) score médio de regiões pareadas Dm/Dp miRNA candidato -> regiões pareadas com maior score dentro de cada super-região WU-BLAST de seq. Dm contra seq. de Anopheles score total dos melhores 3 hits, rankeados com o score médio Dm/Dp 21/24 membros do conjunto referência Dm, foram agrupados com os melhores 600 candidatos a miRNA

23 Predição computacional de miRNA de Drosophila 3. Avaliar padrões de divergência em stem- loops conservados

24 Aplicação de Filtros booleanos – Remoção de regiões com alto score e/ou alta conservação que não são candidatas à miRNA. Trimagem da ponta fora do braço principal Blocos conservados de pelo menos 22 nt Estes blocos devem estar localizados a aproximadamente 10 nucleotídeos do loop final Remoção das classes 4, 5 e 6 ~ 1/3 dos stem-loops conservados passaram pelos filtros 18/24 (75%) sequências (conjunto referência) estavam entre os primeiros 124 candidatos

25 Predição computacional de miRNA de Drosophila 3. Avaliar padrões de divergência em stem- loops conservados

26 570 passaram pelo filtro de conservação (barra verde) 124 miRseeker candidatos: conjunto referência (verde) novos miRNA (azul) miRNA conservados em uma terceira espécie (laranja)

27 Predição computacional de miRNA de Drosophila 3. Avaliar padrões de divergência em stem- loops conservados Top 600 (21/24) Após o filtro booleano: 200 (18/24) 42 novos candidatos em 200 melhores predições apresentaram conservação de sequência e estrutura em outras espécies (Anopheles e Apis)

28 Validação experimental dos novos candidatos à miRNA 24 novos miRNA foram validados por northern-blot de RNA total isolado de embriões, larvas/pupa e adulto de Drosophila

29

30 Conclusão miRseeker identificou com sucesso os genes de miRNA conhecidos em Drosophila 32 novos miRNA foram identificados pelo miRseeker, sendo que 24 deles foram validados por northern blot estima-se a presença de 110 genes de miRNA em Drosophila (1% dos genes codificantes, em concordância com vertebrados) divergência dentro da região loop foi inesperada. Duas conclusões: a região de loop parece ser menos crítica no pré-miRNA deve haver uma pressão de seleção na sequência que forma a região stem, já que a Dicer atua na estrutura helicoidal (braço)

31 Referências bibliográficas Lai et al. (2003) Computacional identification of Drosophila microRNA genes. Genome Biology, 4(7):R42 Ambros (2001) MicroRNAs: Tiny regulators with Great Potential. Cell, 107: Pasquinelli (2002) MicroRNAs: deviants no longer. TRENDS in Genetics 18(4): Moss (2002) MicroRNAs: Hidden in the Genome. Current Biology 12:R138-R140 Mount (2001) Bioinformatics. Sequence and Genome analysis. pp Bray et al.(2003) AVID: A Global Alignment Program. Genoma Research 13:97-102


Carregar ppt "Identificação computacional de genes de microRNA Alexandre dos Santos Cristino Bruno Augusto N. Travençolo César Beltrán Castañón Elza Helena Andrade Barbosa."

Apresentações semelhantes


Anúncios Google