A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Dr. Salmo Raskin. Ácido Desoxirribonucleico Todas as células nucleadas contém DNA em 23 pares de cromossomos. Cromossomos X Mãe Pai X Pai Célula.

Apresentações semelhantes


Apresentação em tema: "Dr. Salmo Raskin. Ácido Desoxirribonucleico Todas as células nucleadas contém DNA em 23 pares de cromossomos. Cromossomos X Mãe Pai X Pai Célula."— Transcrição da apresentação:

1 Dr. Salmo Raskin

2 Ácido Desoxirribonucleico Todas as células nucleadas contém DNA em 23 pares de cromossomos. Cromossomos X Mãe Pai X Pai Célula

3

4

5

6

7 O que foi o PROJETO GENOMA HUMANO? Colaboração científica internacional organizada pelo EUA, através do Departmento de Energia e o Insituto Nacional de Saúde Colaboração científica internacional organizada pelo EUA, através do Departmento de Energia e o Insituto Nacional de Saúde Objetivos ( ) Objetivos ( ) identificar a posição dos genes no DNA humano identificar a posição dos genes no DNA humano determinar a sequência das 3 bilhões de bases nitrogenadas que compõem o DNA humano determinar a sequência das 3 bilhões de bases nitrogenadas que compõem o DNA humano Guardar esta informação em bases de dados Guardar esta informação em bases de dados Desenvolver métodos para analisar estes dados Desenvolver métodos para analisar estes dados Estudar os aspectos éticos, legais, e sociais que surgirão com as novas descobertas Estudar os aspectos éticos, legais, e sociais que surgirão com as novas descobertas Colaboração científica internacional organizada pelo EUA, através do Departmento de Energia e o Insituto Nacional de Saúde Colaboração científica internacional organizada pelo EUA, através do Departmento de Energia e o Insituto Nacional de Saúde Objetivos ( ) Objetivos ( ) identificar a posição dos genes no DNA humano identificar a posição dos genes no DNA humano determinar a sequência das 3 bilhões de bases nitrogenadas que compõem o DNA humano determinar a sequência das 3 bilhões de bases nitrogenadas que compõem o DNA humano Guardar esta informação em bases de dados Guardar esta informação em bases de dados Desenvolver métodos para analisar estes dados Desenvolver métodos para analisar estes dados Estudar os aspectos éticos, legais, e sociais que surgirão com as novas descobertas Estudar os aspectos éticos, legais, e sociais que surgirão com as novas descobertas

8 1) Consórcio Internacional de Sequenciamento do Genoma Humano 20 Centros, 6 países 2) Empresa Celera Coordenação: Craig Venter Coordenação: Dr. Francis Collins National Human Genome Research Institute (NHGRI) National Institute of Health (NIH) Coordenação: Dr. Francis Collins National Human Genome Research Institute (NHGRI) National Institute of Health (NIH)

9 Projeto Genoma Humano Dr. Craig Venter Dr. Francis Collins

10

11 Lander et al. (248 autores) Initial Sequencing and Analysis of The Human Genome Nature 2001, 409: Venter et al. (282 autores) The Sequence of The Human Genome Science 2001, 291:

12

13

14 GTCGTTTTACAACGTCGTGACTGGGGAAAACCCTGGGCGTTACCCAACTTAATCGCCTTGGCNGCACATCCCCCTTTCGCA GNTGGGGTAATAACGAAANANGCCGGACCGATCGNCCTTCCCAANAATTGCNCAACCTGAATGGGGAATGGACNCCCCTG TAACGGCGCATTAANCGCGGNGGGTGTGGTGGTTAACNGCAAGGNGAAGGTAAANTTGGAAGGGGNTAAGGGGGGGNNT TTTGGTTTTTTTTGCTCACTTCTTTTCCTTATGGCCAGTAAAAGTGGTGTGTGGCCAGCTTGATTCTCTTCTCTCAATGATCCC AAGATTCCAGATGACAATGTCAGGCACTCCTGCTCTAAATGGGTCACTAAGGAAGTGGCTCTTGTTCTTCACTTTGATGTCT GCACCACAGGACAGCAATTTTGCCACCACTGACAAATTCTCACCATAAACAGCATAATGGACAGCTGTGTTGACATACACAT CTACAATATTTGGATCAGCACCAGAATCTATGANAATATTTGCACAAACTTCCCTCTGGCATTGCACAGCCTCTTCTTCGCAT CTCTTATGTTCAGGTCCATTGTCGTCTTCAAGCCGAATTCTGCAGATATCCATCACACTGGCGGNCGCTCGAGCATGCATCT AGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTAAATTCACTGGGCCGTCGTTTTACAACGTCGTGACTGGGGAAAACCC TGGGCGTTACCCAACTTAATCGCCTTGGCNGCACATCCCCCTTTCGCAGNTGGGGTAATAACGAAANANGCCGGACCGATC GNCCTTCCCAANAATTGCNCAACCTGAATGGGGAATGGACNCCCCTGTAACGGCGCATTAANCGCGGNGGGTGTGGTGGT TAACNGCAAGGNGAAGGTAAANTTGGAAGGGGNTAAGGGGGGGNNTTTTGGTTTTTTTTTTTTTTCCCCCCCCCCCCCCCC CCCCTTGCTCACTTCTTTTCCTTATGGCCAGTAAAAGTGGTGTGTGGCCAGCTTGATTCTCTTCTCTCAATGATCCCAAGATT CCAGATGACAATGTCAGGCACTCCTGCTCTAAATGGGTCACTAAGGAAGTGGCTCTTGTTCTTCACTTTGATGTCTGCACCA CAGGACAGCAATTTTGCCACCACTGACAAATTCTCACCATAAACAGCATAATGGACAGCTGTGTTGACATACACATCTACAA TATTTGGATCAGCACCAGAATCTATGANAATATTTGCACAAACTTCCCTCTGGCATTGCACAGCCTCTTCTTCGCATCTCTTAT GTTCAGGTCCATTGTCGTCTTCAAGCCGAATTCTGCAGATATCCATCACACTGGCGGNCGCTCGAGCATGCATCTAGAGGG CCCAATTCGCCCTATAGTGAGTCGTATTAAATTCACTGGGCCGTCGTTTTACAACGTCGTGACTGGGGAAAACCCTGGGCGT TACCCAACTTAATCGCCTTGGCNGCACATCCCCCTTTCGCAGNTGGGGTAATAACGAAANANGCCGGACCGATCGNCCTTC CCAANAATTGCNCAACCTGAATGGGGAATGGACNCCCCTGTAACGGCGCATTAANCGCGGNGGGTGTGGTGGTTAACNGC AAGGNGAAGGTAAANTTGGAAGGGGNTAAGGGGGGGNNCCCCCCCCCTTGCTCACTTCTTTTCCTTATGGCCAGTAAAAG TGGTGTGTGGCCAGCTTGATTCTCTTCTCTCAATGATCCCAAGATTCCAGATGACAATGTCAGGCACTCCTGCTCTAAATGG GTCACTAAGGAAGTGGCTCTTGTTCTTCACTTTGATGTCTGCACCACAGGACAGCAATTTTGCCACCACTGACAAATTCTCA CCATAAACAGCATAATGGACAGCTGTGTTGACATACACATCTACAATATTTGGATCAGCACCAGAATCTATGANA Só 1,5% são Genes...

15

16 MutaçõesMutações ACT GGG CAC CTAsequência normal ACT AGG CAC CTAmutação de ponto ACT GGG CTAdeleção sem desvio da leitura ACT GGG C CTAdeleção com desvio da leitura ACT GTGGCAC CTAinserção com desvio da leitura ACT GGG CAC CTAsequência normal ACT AGG CAC CTAmutação de ponto ACT GGG CTAdeleção sem desvio da leitura ACT GGG C CTAdeleção com desvio da leitura ACT GTGGCAC CTAinserção com desvio da leitura

17 Principais Conclusões do PGH Maior genoma sequenciado até hoje Maior genoma sequenciado até hoje Primeiro Genoma de Vertebrado Sequenciado Primeiro Genoma de Vertebrado Sequenciado Tamanho de 3.2 Gb Tamanho de 3.2 Gb 99,99% sequenciado 99,99% sequenciado % codifica para proteína % codifica para proteína >50% são sequencias repetitivas >50% são sequencias repetitivas Maior genoma sequenciado até hoje Maior genoma sequenciado até hoje Primeiro Genoma de Vertebrado Sequenciado Primeiro Genoma de Vertebrado Sequenciado Tamanho de 3.2 Gb Tamanho de 3.2 Gb 99,99% sequenciado 99,99% sequenciado % codifica para proteína % codifica para proteína >50% são sequencias repetitivas >50% são sequencias repetitivas

18 Principais Conclusões do PGH Número total de genes anotados: Número total de genes anotados: (47%) com uma estrutura definida, representado por uma sequencia de cDNA (47%) com uma estrutura definida, representado por uma sequencia de cDNA (54%) com uma estrutura prevista (54%) com uma estrutura prevista Número total de genes anotados: Número total de genes anotados: (47%) com uma estrutura definida, representado por uma sequencia de cDNA (47%) com uma estrutura definida, representado por uma sequencia de cDNA (54%) com uma estrutura prevista (54%) com uma estrutura prevista

19 Principais Conclusões do PGH A densidade gênica é desigual, relacionada ao conteúdo de guanosina e citidina (GC) e aos padrões de bandeamento dos cromossomos A densidade gênica é desigual, relacionada ao conteúdo de guanosina e citidina (GC) e aos padrões de bandeamento dos cromossomos Cromossomo 22 é um pouco maior que o 21, mas tem o dobro de genes (545 /225) Cromossomo 22 é um pouco maior que o 21, mas tem o dobro de genes (545 /225) A densidade gênica é desigual, relacionada ao conteúdo de guanosina e citidina (GC) e aos padrões de bandeamento dos cromossomos A densidade gênica é desigual, relacionada ao conteúdo de guanosina e citidina (GC) e aos padrões de bandeamento dos cromossomos Cromossomo 22 é um pouco maior que o 21, mas tem o dobro de genes (545 /225) Cromossomo 22 é um pouco maior que o 21, mas tem o dobro de genes (545 /225) PROJETO GENOMA HUMANO

20 Os Humanos tem menos genes do que se esperava Os Humanos tem menos genes do que se esperava Número inicial: genes Número inicial: genes Estimativa atual: genes Estimativa atual: genes só mais do que a Drosophyla melanogaster só mais do que a Drosophyla melanogaster só mais do que C. elegans só mais do que C. elegans Número estimado de proteínas derivadas destes genes: transcritos se iniciam em pontos alternativos de um mesmo gene Número estimado de proteínas derivadas destes genes: transcritos se iniciam em pontos alternativos de um mesmo gene Um único gene pode produzir vários transcritos diferentes Um único gene pode produzir vários transcritos diferentes Os Humanos tem menos genes do que se esperava Os Humanos tem menos genes do que se esperava Número inicial: genes Número inicial: genes Estimativa atual: genes Estimativa atual: genes só mais do que a Drosophyla melanogaster só mais do que a Drosophyla melanogaster só mais do que C. elegans só mais do que C. elegans Número estimado de proteínas derivadas destes genes: transcritos se iniciam em pontos alternativos de um mesmo gene Número estimado de proteínas derivadas destes genes: transcritos se iniciam em pontos alternativos de um mesmo gene Um único gene pode produzir vários transcritos diferentes Um único gene pode produzir vários transcritos diferentes Principais Conclusões do PGH PROJETO GENOMA HUMANO

21 Funções dos Genes Adesão Celular Regulação do Ciclo Celular DefesaImunidadeEnzimática Regulação Enzimática Transportador de Proteínas Proteína Fator de Transcrição Supressor de Tumor genes Não foi possível classificar cerca de 40% destes em nenhuma categoria funcional

22 As taxas de mutações gênicas são duas vezes maiores em homens do que em mulheres As taxas de mutações gênicas são duas vezes maiores em homens do que em mulheres Principais Conclusões do PGH PROJETO GENOMA HUMANO

23 1) Diagnósticas Doenças Monogênicas Doenças Monogênicas Detecção de afetados e portadores Detecção de afetados e portadores Doenças Comuns Doenças Comuns Cancer Cancer Obesidade Obesidade Diabetes Diabetes Hipertensão Arterial Hipertensão Arterial 1) Diagnósticas Doenças Monogênicas Doenças Monogênicas Detecção de afetados e portadores Detecção de afetados e portadores Doenças Comuns Doenças Comuns Cancer Cancer Obesidade Obesidade Diabetes Diabetes Hipertensão Arterial Hipertensão Arterial Implicações para as Ciências da Vida PROJETO GENOMA HUMANO

24 Clonagem do gene da FC

25 RNAm de CFTR

26 Mutação DF508 do Gene CFTR Seqüência Selvagem de Parte do Éxon 10 de CFTR DNADNAGAGAAATAATATCATCATCATCTTTTTTGGTGGTGTTGTTTCCTCC AminoácidoAminoácidoGluGluAsnAsnIleIleIleIlePhePheGlyGlyValValSerSer CódonCódon DNADNAGAGAAATAATATCATCAT-AT---T--TGGTGGTGTTGTTTCCTCC AminoácidoAminoácidoGluGluAsnAsnIleIleIleIle GlyGlyValValSerSer Seqüência de Parte do Éxon 10 de CFTR com a Mutação DF508 CódonCódon Fonte: GELEHRTER;COLLINS, 1990 (Adaptado).

27 Fenilalanina no Codon 508 de CFTR Fonte: F.S. COLLINS, J.R. RIORDAN, and L.C. TSUI; Hospital Practice Phe 508

28 Proteína CFTR Fonte: COLLINS; RIORDAN; TSUI, PLN: Prega ligadora de nucleotídio Extracelular Intracelular NH 2 CO 2 H PLN Domínios de ligação de ATP Domínio regulador Domínios transmembranicos PLN

29 DNADNA RNARNA ProteinaProteina Função celular

30 A Expressão Gênica depende do tipo de Célula

31

32 Microarranjos de cDNA para estudar a expressão gênica

33

34

35 2) Farmacogenéticas Medicina Personalizada já é uma realidade !!! Medicina Personalizada já é uma realidade !!! Herceptina (trastuzumab, Roche, Basel, Switzerland) Herceptina (trastuzumab, Roche, Basel, Switzerland) só é efetiva contra um sub-grupo de cancers de Mama com amplificação do proto-oncogene neu/ErbB só é efetiva contra um sub-grupo de cancers de Mama com amplificação do proto-oncogene neu/ErbB é a primeira droga no mercado que necessita de um teste genético antes de ser usada! é a primeira droga no mercado que necessita de um teste genético antes de ser usada! 2) Farmacogenéticas Medicina Personalizada já é uma realidade !!! Medicina Personalizada já é uma realidade !!! Herceptina (trastuzumab, Roche, Basel, Switzerland) Herceptina (trastuzumab, Roche, Basel, Switzerland) só é efetiva contra um sub-grupo de cancers de Mama com amplificação do proto-oncogene neu/ErbB só é efetiva contra um sub-grupo de cancers de Mama com amplificação do proto-oncogene neu/ErbB é a primeira droga no mercado que necessita de um teste genético antes de ser usada! é a primeira droga no mercado que necessita de um teste genético antes de ser usada! Implicações para as Ciências da Vida PROJETO GENOMA HUMANO

36

37 A Era Pós-Projeto Genoma Humano Determinação de Riscos Determinação Plano de rastreamento amplo de doenças Modificação dos riscos existentes Modificação dos riscos existentes Estratégias de Prevenção Manejo das Doenças

38

39

40

41

42

43 Terapia Gênica Como é feita? Como é feita? Isolando o DNA a ser inserido na célula Isolando o DNA a ser inserido na célula Empacotando o DNA em vetores Empacotando o DNA em vetores Transferindo o DNA para dentro das células-alvo Transferindo o DNA para dentro das células-alvo Fazendo o DNA se expressar nas células- alvo Fazendo o DNA se expressar nas células- alvo Como é feita? Como é feita? Isolando o DNA a ser inserido na célula Isolando o DNA a ser inserido na célula Empacotando o DNA em vetores Empacotando o DNA em vetores Transferindo o DNA para dentro das células-alvo Transferindo o DNA para dentro das células-alvo Fazendo o DNA se expressar nas células- alvo Fazendo o DNA se expressar nas células- alvo

44 O Gene a ser transferido

45 Experiências em humanos são animadoras!

46

47

48

49


Carregar ppt "Dr. Salmo Raskin. Ácido Desoxirribonucleico Todas as células nucleadas contém DNA em 23 pares de cromossomos. Cromossomos X Mãe Pai X Pai Célula."

Apresentações semelhantes


Anúncios Google