A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Da Genômica ao Melhoramento Luis E. Aranha Camargo Dept. Entomologia, Fitopatologia e Zoologia Agrícola ESALQ/USP Piracicaba.

Apresentações semelhantes

Apresentação em tema: "Da Genômica ao Melhoramento Luis E. Aranha Camargo Dept. Entomologia, Fitopatologia e Zoologia Agrícola ESALQ/USP Piracicaba."— Transcrição da apresentação:

1 Da Genômica ao Melhoramento Luis E. Aranha Camargo Dept. Entomologia, Fitopatologia e Zoologia Agrícola ESALQ/USP Piracicaba

2 Genômica Ciência que analisa estrutura, composição e funcionalidade de genomas

3 Sequenciamento Análise estrutural Análise comparativa Análise funcional (várias abordagens: SAGE, microarranjos, RT-PCR, análise in silico, etc) Objetivo:Identificar genes e suas funções Grande volume de informação Genômica Mineração ou garimpagem

4 gene fenótipo genética vegetal variação genética variação fenotípica melhoramento vegetal O melhorista objetiva relacionar variantes de um gene (alelos)com variações em fenótipos de modo a identificar os melhores alelos ESTs seqüências genômicas SAGE proteômica análise de mutantes bioinformática

5 FENÓTIPO melhoristas usam uma variedade de estratégias para separar os efeitos da variância genética da ambiental... F = G + A

6 -se baseia na análise de médias e variâncias para selecionar melhores genótipos -pouco se sabe sobre os genes que controlam a característica -seleção baseada no somatório dos efeitos dos genes que controlam a característica idéia é associar variações alélicas em certos genes candidatos com variações em fenótipos idéia tornou-se palpável a partir do desenvolvimento da Genômica mas o que são genes candidatos?

7 Efeito menor em maisina e resistência Resistência a lagarta da espiga (McMullen et al., PNAS 95, 1998) Efeito maior em maisina e resistência Outros locos, efeito na resistência mas não em maisina

8 Projetos ESTs são fontes de genes cadidadtos TIGR Soybean Gene Index (GmGI)

9 PAL peroxidades Lipoxigenase Necessidade de conhecimento de vias metabólicas Genes R Pr proteínas


11 variedade resistente 0% doença variedade suscetível 60% doença palatccctcatttggGatctaggtg atccctcatttggTatctaggtg loxcggtacacgtttaccagggtcA cggtacacgtttaccagggtcG pr-1ggcttgacatgcaaatcagga ggcttgacatgcaaatcagga etc... Associação de alelos com fenótipos (análise de ligação) – cruzamentos experimentais Progênie de linhagens recombinantes é classificada de acordo com genótipos esperados no gene pal genótipos parentais em gene candidatos genes candidatos atccctcatttggGatctaggtgatccctcatttggTatctaggtg Doença17%37% Presença do alelo G a no locus pal está associada com uma reduçaõ de 54% na quantidade de doença

12 Problema Problema : a lista de genes candidatos ainda é pequena pois a maioria das vias metabólicas que controlam características de importância agronômica é incompleta e aqui é onde a Genômica Funcional entra… para completar esta vias metabólicas por meio de uma série de técnicas (genética reversa e direta, análise de expressão gênica via microarranjos, SAGE, e de bancos de EST, etc.)

13 SAGE (aguardem…)

14 Hibridização in silico: auxílio na seleção de marcadores candidatos Comparações entre bibliotecas de ESTs geradas sob condições distintas podem servir de base para identificar marcadores candidatos

15 inoculação Expressão de genes de resistência Produtos dos genes estarão Presentes na amostra de RNAm Comparar com biblioteca feita de RNAm de planta não inoculada

16 Comparação entre bibliotecas ESTs de feijoeiro geradas de plantas inoculadas ou não com Colletotrichum inoculada não inoc. Genes candidatos para cruzamentos experimentais

17 Expressão diferencial com Auxílio de arranjos Hibridização em microarranjos (microarrays) Permite estudar a expressão de vários genes de uma só vez Genes são dispostos em lâminas ou “chips” (Sanghyeob et al., 2004) (Gibly et al., 2004)

18 ………… Microchip contendo genes RNAm de planta inoculada RNAm de planta não inoculada Expressão gênica diferencial Síntese de cDNA e marcação com marcadores fluorescentes cDNA hibridização

19 Genes somente expressos em plantas inoculadas Gene somente expresso em plantas não inoculadas Expressão em ambas situações

20 Análise de expressão gênica de indivíduos fenotipicamente distintos - descoberta de genes candidatos e.g.- análise da expressão gênica de fenótipos extremos de uma população segregante Schadt et al., Nature 2003, 422:297-302 Perfil de expressão Diferenças em expressão gênica devem Ser específicas ao fenótipo e Genótipo que separam os grupos Genes candidatos RNAm

21 EST Vias metabólicas SAGE Análise in silico SNPs GENÔMICA MELHORAMENTO para análise de ligação em cruzamentos experimentais Microarranjos Sequenciamento genômico

22 Obrigado! Luis E. Aranha Camargo leacamar@esalq.usp.br

Carregar ppt "Da Genômica ao Melhoramento Luis E. Aranha Camargo Dept. Entomologia, Fitopatologia e Zoologia Agrícola ESALQ/USP Piracicaba."

Apresentações semelhantes

Anúncios Google