A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

BIOLOGIA MOLECULAR NA GENÉTICA FORENSE ou Apesar do DNA, as Probabilidades de Sempre...

Apresentações semelhantes


Apresentação em tema: "BIOLOGIA MOLECULAR NA GENÉTICA FORENSE ou Apesar do DNA, as Probabilidades de Sempre..."— Transcrição da apresentação:

1 BIOLOGIA MOLECULAR NA GENÉTICA FORENSE ou Apesar do DNA, as Probabilidades de Sempre...

2 MAIO 2004O DNA e a LEI2 REPETIÇÃO IN TANDEN 3-CGTAAATCTAGGTGTCGTCTACTAAAG-5 5-GCATTTAGATCCACAGCAGATGATTTC-3 3-CGTAAATCTAGGTGTCGTCTACTAAAG-5 5-GCATTTAGATCCACAGCAGATGATTTC-3 5-GCATTTAGATCCACAGCAGCAGCAGCAGATGTTTC-3 3-CGTAAATCTAGGTGTCGTCGTCGTCGTCTACAAAG-5 5-GCATTTAGATCCACAGCAGCAGCAGCAGATGTTTC-3 3-CGTAAATCTAGGTGTCGTCGTCGTCGTCTACAAAG-5

3 MAIO 2004O DNA e a LEI3 5'3' DNA dupla fita Região alvo primers DNTPs Taq DNA pol. A TÉCNICA DE PCR - CICLO I Desnaturação das fitas de DNA Pareamento dos primers Alongamento das novas fitas

4 MAIO 2004O DNA e a LEI4 5'3' Região alvo Desnaturação das fitas de DNA Pareamento dos primers Alongamento das novas fitas A TÉCNICA DE PCR - CICLO II

5 MAIO 2004O DNA e a LEI5 2 CAGATACCGCTCGCGCTCGACGACACAGCCAT 4 CAGATACCGCTCGCGCTCGACGACGACGACACAGCCAT 5 CAGATACCGCTCGCGCTCGACGACGACGACGACACAGCCAT 6 CAGATACCGCTCGCGCTCGACGACGACGACGACGACACAGCCAT 2/6 5/6 4/6 2/4 STRS = SHORT TANDEM REPEATS

6 MAIO 2004O DNA e a LEI6 ELEMENTOS BÁSICOS MICRO- SATÉLITES (STRs)

7 MAIO 2004O DNA e a LEI7 ELEMENTOS BÁSICOS MICRO- SATÉLITES (STRs)

8 MAIO 2004O DNA e a LEI8 Nova aparência

9 MAIO 2004O DNA e a LEI9 inclusão exclusão inclusão exclusão ELEMENTOS BÁSICOS 1/23/4 2/3 1/24/5 2/3 LOCUS GENE ALELO Alelo paterno obrigatório

10 MAIO 2004O DNA e a LEI10 PV PROBABILIDADE DO TRIO SER VERDADEIRO PV = P(M 1/2) P(P 3/4) P(F 2/3 | M 1/2, P 3/4) PV = P(M) P(P) P(F | M,P) 1/23/4 2/3 probabilidade de se encontrar um trio com os fenótipos observados e que o suposto pai é o pai biológico

11 MAIO 2004O DNA e a LEI11 PF PROBABILIDADE DO TRIO SER FALSO PF = P(M 1/2) P(P 3/4) P(F 2/3|M 1/2, P ) PF = P(M) P(P) P(F | M) probabilidade de se encontrar um trio compatível, com os fenótipos observados e que o suposto pai não é o pai biológico. 1/23/4 2/3

12 MAIO 2004O DNA e a LEI12 IP ÍNDICE DE PATERNIDADE PV IP = PF IP = P(M) P(P) P(F | M,P) P(M) P(P) P(F | M) Simplificando, IP se baseia em apenas duas probabilidades: Simplificando, IP se baseia em apenas duas probabilidades: (a) de que o casal M e P produza o filho (a) de que o casal M e P produza o filho (b) de que a M tenha o filho (b) de que a M tenha o filho = P(F | M,P) P(F | M)

13 MAIO 2004O DNA e a LEI13 CÁLCULO DO IP P(F | M) = 0,5 p 3 P(F | M) = 0,5 p 3 P(F | M,P) = 0,25 1/23/4 1/42/31/32/4 1/2 2/ 1/ Neste caso: IP = 0,25 / 0,5 p 3 IP = 0,5 / p 3

14 MAIO 2004O DNA e a LEI14 CÁLCULO DO ÍNDICE REGRA SIMPLES MãeFilhoAPO1/11/##/# 1/11/111½Ø p1p1p1p1 1/##ؽ1 p1p1p1p1 1/21/111½Ø ½ p 1 1/21,2 1/# ou 2/# #

15 MAIO 2004O DNA e a LEI15 Freqüência alélica e valores do índice 0,1 0,1 0,1 0,4 0,8 5 1,25 0,625 freqüência índice Quanto mais raro o alelo, maior o índice de paternidade

16 MAIO 2004O DNA e a LEI16 LAUDO EXCLUSÃO

17 MAIO 2004O DNA e a LEI17 LAUDO INCLUSÃO

18 MAIO 2004O DNA e a LEI ,99 0,999 0,9999 0, , , ÍNDICE e PROBABILIDADE 99 % 99 % 99,9 % 99,9 % 99,99 % 99,99 % 99,999 % 99,999 % 99,9999 % 99,9999 % % % ÍNDICEPROB IP IP+1 PP =

19 MAIO 2004O DNA e a LEI19 CRITÉRIOS PARA INCLUSÃO Probabilidade mínima 99,99% IP > Descontar o maior IP Não há número mínimo de exames Loci geneticamente não ligados

20 MAIO 2004O DNA e a LEI20 1/8000 1/3000 1/ ÍNDICES PARA EVIDÊNCIAS NÃO GENÉTICAS VASECTOMIA OUTRAS EVIDÊNCIAS TOTAL

21 MAIO 2004O DNA e a LEI / / ÍNDICE COMPOSTO Observe-se que a ordem dos fatores não altera o produto ! EXAMES LABORATÓRIO 1 OUTRAS EVIDÊNCIAS ÍNDICE COMPOSTO 1 EXAMES LABORATÓRIO 2 ÍNDICE FINAL

22 MAIO 2004O DNA e a LEI22 CONCLUSÕES.1 Qualquer evidência não genética Qualquer evidência não genética Índice final Índice final Limite mínimo : Limite mínimo : quantificada na forma de índice. Produto dos índices individuais. Probabilidade de 99,99% Índice: para qualquer índice das evidências não genéticas, sempre haverá um conjunto de exames de dna tal que seu índice neutralizará qualquer índice atribuído às outras evidências.

23 MAIO 2004O DNA e a LEI23 CONCLUSÕES.2 Se se aceita a idéia de que todas as evidências não genéticas sejam quantificáveis numericamente, e acreditamos que sejam, para qualquer investigação de paternidade pode ser obtida resposta definitiva exclusivamente pelo DNA.

24 IMPLICAÇÕES E COMENTÁRIOS

25 MAIO 2004O DNA e a LEI25 1/8000 1/3000 1/ ÍNDICES PARA EVIDÊNCIAS NÃO GENÉTICAS VASECTOMIA OUTRAS EVIDÊNCIAS TOTAL

26 MAIO 2004O DNA e a LEI26 DESAFIOS ÉTICOS Denúncia materna oitiva de testemunhas material hospitalar (sobras de necrópsia, exames, etc) Amostras de exames anteriores A recusa de se submeter aos exames Suficiente? Desnecessária?! pertencem à família? O Juiz pode determinar seu uso? Podem ser usadas à revelia da família? Prova de culpa do acusado.

27 MAIO 2004O DNA e a LEI27 FONTES DE DNA e alguns problemas Sangue periférico Esfregaço celulas mucosa oral Líquido Seminal Ossos Fios de cabelo GRANDE PROBLEMA : Troca de amostras Transfusão NÃO afeta exame ESTOCAGEM : Glicerol ou em Papel assinado ÉTICA : Autorizações Materna e Paterna

28 MAIO 2004O DNA e a LEI28 PERÍCIA INDIRETA - INFERÊNCIA DE UM GENÓTIPO PELO EXAME DE FAMILIARES 1 / 2 2 / 3 1 / 2 2 / 4 1/2 1/4 2/2 2/4 Se 3 no lugar de 4 e p(3)=0,1 IP = 0,5 x 0,5 / 0,1 = 2.5

29 MAIO 2004O DNA e a LEI29 QUESTÕES FREQÜENTES Exumação vs Exame dos familiares Exumação vs Exame dos familiares Exumação: Exumação: Material degradado (fragmentos muito pequenos); Material degradado (fragmentos muito pequenos); Pequena quantidade; Pequena quantidade; Contaminação por DNA estranho (principalmente de fungos, bactérias e larvas de insetos, mas também dos colhedores das amostras). Contaminação por DNA estranho (principalmente de fungos, bactérias e larvas de insetos, mas também dos colhedores das amostras). Exame dos Familiares: Exame dos Familiares: Número de locos + número de familiares – Quanto mais, melhor. Número de locos + número de familiares – Quanto mais, melhor. Identificação Humana – O DNA mitocondrial Identificação Humana – O DNA mitocondrial

30 MAIO 2004O DNA e a LEI30 OUTRAS QUESTÕES FREQÜENTES Freqüências alélicas brasileiras EXISTEM Freqüências alélicas brasileiras EXISTEM Os exames clássicos: Os exames clássicos: O que não exclui, inclui ! O que não exclui, inclui ! Eram razoavelmente poderosos Eram razoavelmente poderosos Nem todos devem ser revistos – só baixas probabilidades de exclusão Nem todos devem ser revistos – só baixas probabilidades de exclusão Probabilidade a priori – 50% Probabilidade a priori – 50% A Probabilidade de Paternidade não é uma probabilidade... A Probabilidade de Paternidade não é uma probabilidade...

31 MAIO 2004O DNA e a LEI31 TIPOS DE EXAME LABORATORIAL Sondas Multilocais unilocais STRs por PCR Alto custo. Grande quantidade de DNA. Treinamento; falta de repetiblidade. Não permitem cálculo preciso. Subjetiva ! Alto custo. Grande Quantidade de DNA. Excesso de alelos impede classificação precisa. Procedimento de escolha.

32 MAIO 2004O DNA e a LEI32 MICROSSATÉLITES DETECTADOS POR PCR TAXA DE MUTAÇÃO SUPRESSÃO ALÉLICA REFERENCIAL NOMENCLATURA Soluções: TRÊS EXCLUSÕES EXCLUSÕES DIRETAS AMOSTRAS CLONADAS e SEQÜENCIADAS NOMENCLATURA - falso problema


Carregar ppt "BIOLOGIA MOLECULAR NA GENÉTICA FORENSE ou Apesar do DNA, as Probabilidades de Sempre..."

Apresentações semelhantes


Anúncios Google