A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Desenvolvimento de construções gênicas para a transformação de plantas Ricardo Harakava Pesquisador Científico Laboratório de Bioquímica Fitopatológica.

Apresentações semelhantes


Apresentação em tema: "Desenvolvimento de construções gênicas para a transformação de plantas Ricardo Harakava Pesquisador Científico Laboratório de Bioquímica Fitopatológica."— Transcrição da apresentação:

1 Desenvolvimento de construções gênicas para a transformação de plantas Ricardo Harakava Pesquisador Científico Laboratório de Bioquímica Fitopatológica Instituto Biológico

2 Transformação via Agrobacterium

3 Agrobacterium tumefaciens Um cromossomo linear de 2 Mb e um circular de 2.8 Mb Plasmídeo Ti (tumor- inducing) de 200 Kb Transformação via Agrobacterium

4

5 Infecção de plantas por Agrobacterium

6 Transformação de plantas através de Agrobacterium

7 Gene Gun - Biobalística Desenvolvido por John Sanford da Cornell University, em 1987 Particularmente útil para aquelas espécies que se mostraram previamente difíceis de transformação por Agrobacterium (monocotiledôneas) Única forma de introduzir genes em cloroplastos

8 Como funciona? Cobertura de partículas de ouro ou tungstênio com o DNA de interesse Complexo partícula-DNA acelerado sob vácuo, atingindo tecido alvo As células recebem o DNA diretamente

9

10 Trabalhando com o Gene Gun

11 Comparação Agrobacterium x Biobalística Agrobacterium: DNA é integrado preferencialmente em algumas regiões do cromossomo denominadas hot spots; baixo número de cópias; mais eficiente em dicotiledôneas Biobalística: integração do DNA é aleatória; elevado número de cópias; aplicável a um amplo espectro de plantas

12 Vetores para transformação via Agrobacterium série pCAMBIA pBIN19, pBINPLUS pBI121 etc, etc, etc

13 Estrutura de um vetor

14 Genes de seleção npt II – resistência a canamicina bar – resistência a herbicida PPT (phosphinothricin) hpt II – resistência a hygromicina man A – utilização de manose (seleção positiva) xyl A – utilização de xilose Revisão sobre marcadores: Aragão e Brasileiro, Braz. J. Plant Physiol., 14(1):1-10, 2002

15 Modelo de vetor para obtenção de plantas transgênicas sem marca de resistência

16 Genes reporter uidA – GUS GFP (green fluorescent protein) luciferase

17 GFP direcionada ao núcleo celular

18 Luciferase em plântula de Arabidopsis

19 Estrutura de um gene eucariótico e seu promotor

20 Exercício: clonagem do gene, em sentido anti-senso, da capa protéica de um vírus em vetor para transformação de plantas CaMV 35S - PCaMV 35S-T HindIII - BamHI - EcoRI - PstI - XhoI Região para inserção do transgene

21 Amplificação do gene Desenho de primers para amplificação do gene por RT-PCR (o vírus é de RNA) Introdução de sítios de restrição nos primers para clonagem no vetor Verificar se as enzimas escolhidas não clivam o gene amplificado Verificar se as enzimas podem ser utilizadas concomitantemente Equilibrar as temperaturas de anelamento dos primers

22 Compatibilidade das enzimas React 1React 2React 3 Hind III Bam HI Eco RI100 Pst I Xho I Nível de atividade nos diferentes tampões (%) Em negrito = tampão recomendado

23 Região codificadora da capa protéica do PFWV 1 agctgtacac agacaagaac gccagtttgg atgagctaca agaatatttg cgtgtcctag 61 attttgagca tacggaaggt tgctgtgaat ccgtgtctct ccaatcatcc actggaaaag 121 ataaagagga ggagagcaaa gatactatcg atgccggagg cgatggagga agaaaagaca 181 aagaaaaaga gaaaagaaca ggaactctgg caacccttga aaatccaaat cccattaatc 241 caaatggtgg tgacggctcg tctctaggta gagacaagga tgttaatgct ggctcgaaag 301 gcagagtagt gcctcgactg caaaagatta ccaagaaaat gaatctgcca acagtgaaag 361 gaagagtgat actcaacttg gatcatttga tcgagtacgc tccaaaccag gtagatttat 421 acaacactag agcgaccaaa tcacagttcg agtcctggta ttctgcagtc caaaaagaat 481 atgagctaga tgacaatcaa atgagcgtca tcatgaatgg tttcatggtt tggtgcattg 541 ataatggcac ctcaccaaat attaatggca tgtgggtgat gatggacgga gatgagcaga 601 ttgaataccc actaaagcca ttagttgaaa atgctcagcc cactctgaga cagataatgc 661 accatttttc tgatgcggct gaggcatata tagagatgag aaattccaaa gagccgtaca 721 tgcctaggta tggtactctg cggaatttga gggacttgag tttggctcgc tatgcttttg 781 acttttatga ggtcacatcc aaaacgccaa acagagcaag agaagcggta gctcagatga 841 aggccgctgc cctcgcgaac gtttccacta ggttgtttgg ccttgatgga aacgtttcaa 901 caaacagcga gaatactgaa aggcacactg caagggacgt taatcaaaac atgcacaccc 961 ttttgggaat gggtcctccg cagtaaaggt taggtaaact gaccacagtt agcatctcgc 1021 attgccttta aatatctata gtagtatagc tttcactctc tttaagttta gtgtggttat 1081 accaccttcc gtcgtgctta ttgtgatagt gtggctttgc caccagtgtc tgtgatatct 1141 atagaataga gtcggggcag ggagaaccat tgcaacgccg gagctttcag agtgggtcac 1201 ccacgcgcac tgaccgaggt ttggcaatgt ttgttgtcct

24 Desenho dos primers 1 agctgtacac agacaagaac gccagtttgg atgagctaca agaatatttg cgtgtcctag tcatcc actggaaaag 61 attttgagca tacggaaggt tgctgtgaat ccgtgtctct ccaatcatcc actggaaaag 121 ataaagagga ggagagcaaa gatactatcg atgccggagg cgatggagga agaaaagaca 181 aagaaaaaga gaaaagaaca ggaactctgg caacccttga aaatccaaat cccattaatc 241 caaatggtgg tgacggctcg tctctaggta gagacaagga tgttaatgct ggctcgaaag 301 gcagagtagt gcctcgactg caaaagatta ccaagaaaat gaatctgcca acagtgaaag 361 gaagagtgat actcaacttg gatcatttga tcgagtacgc tccaaaccag gtagatttat 421 acaacactag agcgaccaaa tcacagttcg agtcctggta ttctgcagtc caaaaagaat 481 atgagctaga tgacaatcaa atgagcgtca tcatgaatgg tttcatggtt tggtgcattg 541 ataatggcac ctcaccaaat attaatggca tgtgggtgat gatggacgga gatgagcaga 601 ttgaataccc actaaagcca ttagttgaaa atgctcagcc cactctgaga cagataatgc 661 accatttttc tgatgcggct gaggcatata tagagatgag aaattccaaa gagccgtaca 721 tgcctaggta tggtactctg cggaatttga gggacttgag tttggctcgc tatgcttttg 781 acttttatga ggtcacatcc aaaacgccaa acagagcaag agaagcggta gctcagatga 841 aggccgctgc cctcgcgaac gtttccacta ggttgtttgg ccttgatgga aacgtttcaa 901 caaacagcga gaatactgaa aggcacactg caagggacgt taatcaaaac atgcacaccc 961 ttttgggaat gggtcctccg cagtaaaggt taggtaaact gaccacagtt agcatctcgc cccaggaggc gtcatt 1021 attgccttta aatatctata gtagtatagc tttcactctc tttaagttta gtgtggttat 1081 accaccttcc gtcgtgctta ttgtgatagt gtggctttgc caccagtgtc tgtgatatct 1141 atagaataga gtcggggcag ggagaaccat tgcaacgccg gagctttcag agtgggtcac 1201 ccacgcgcac tgaccgaggt ttggcaatgt ttgttgtcct

25 Desenho dos primers F: 5 – GAATTCTCATCCACTGGAAAAG – 3 (sítio para Eco RI) Tm = oC R: 5 – AAGCTTTTACTGCGGAGGACCC – 3 (sítio para Hind III) Tm = oC Hind III Eco RI

26 Acrescentar alguns nucleotídeos para digestão direta (sem pré-clonagem) F: 5 – AAAGAATTCTCATCCACTGGAAAAG – 3 (sítio para Eco RI) R: 5 – AAAAAGCTTTTACTGCGGAGGACCC – 3 (sítio para Hind III)

27 Pré-clonagem em vetor pGEM-T A A Produto amplificado por RT-PCR

28 Transferência do gene do vetor de clonagem para o vetor de tranformação Eco RI Hind III Eco RI Hind III

29 Síntese de um gene Genes podem ser sintetizados artificialmente acoplando-se diversos oligonucleotídeos Proteína pode ser modificada para maior atividade ou estabilidade (resistência a proteases da planta) Adição de peptídeos sinalizadores permitem direcionamento da proteína para diferentes compartimentos celulares Códons podem ser escolhidos para otimização da expressão na planta alvo

30 Exemplo: síntese de uma cecropina modificada Cecropina: peptídeo bactericida produzido por insetos Eficaz em baixas concentrações Não há relatos de desenvolvimento de resistência por parte da bactéria

31 Sintese de gene por PCR

32 Sintese do gene de cecropina modificada

33 Promotores específicos Controle da expressão do transgene para uma otimização de seu efeito ou redução de efeitos não desejáveis Exemplos: tecido-específico, órgão- específico, induzível por estresse hídrico, infecção por patógeno, injúria mecânica, estágio de desenvolvimento

34 Promotor específico ao xilema Cortes transversais de pecíolo de folha de tabaco transgênico contendo gene GUS sob controle do promotor do gene da PAL de Arabidopsis Objetivo: expressão de transgene para controle da bactéria Xylella fastidiosa

35 Passos para obter um promotor algo-específico Identificar um gene que seja expresso especificamente na situação desejada (literatura: estudos de genes diferencialmente expressos, microarrays, ESTs) Verificar se seqüências do gene e seu promotor já estão disponíveis no GenBank (genomas completos de Arabidopsis e arroz estão disponíveis, cuidado com famílias multigênicas) Se o promotor não estiver disponível, utilizar uma das metodologias a seguir...

36 Clonagem de promotores Screening de biblioteca genômica Busca no GenBank Gene-walking (PCR inverso ou com uso de adaptadores)

37 PCR inverso Ochman et al., 1988

38 PCR inverso Hind III Eco RI Bam HI Região do promotorGene com seqüência conhecida Hind III ATG

39 PCR inverso Hind III Digestão com Hind III Hind III ATG

40 PCR inverso Circularização Hind III ATG

41 PCR inverso Hind III Amplificação por PCR Região do promotor ATG

42 Genome walker kit Digestão com diferentes enzimas de restrição, em tubos separados Ligação de adaptadores 1º PCR com primer específico ao gene (GSP1) e primer específico ao adaptador (AP1) - externos 2º PCR com primer específico ao gene (GSP2) e primer específico ao adaptador (AP2) - internos

43 Interferência de RNA Presença de RNA dupla fita (dsRNA) na célula dispara mecanismo de degradação específica Descrito em Caenorhabditis elegans (1998) Ocorre também em plantas, mamíferos, insetos e fungos Forma de proteção do genoma do organismo contra transposons e vírus

44 RNA-induced silencing complex Novina & Sharp, Nature 430:161, 2004 short interfering RNA

45 siRNA nt 3 overhang de 2 nt Produto da ação de RNase tipo III (Dicer)

46 RNAi também atua em processos normais da célula Foram encontradas moléculas pequenas de RNA em diferentes organismos Denominadas microRNAs (miRNAs) nt Codificados pelo próprio genoma do organismo, derivados de RNAs em forma de grampo (hairpin) Função: regulação da expressão de mRNA (particularmente em processos de diferenciação e desenvolvimento)

47 Em animais, miRNAs são parcialmente complementares ao mRNA alvo Um tipo de miRNA pode ter diferentes mRNAs alvos Regra geral, miRNAs ligam-se em vários trechos próximos a extremidade 3 não traduzida do mRNA Essa ligação não leva à degradação do mRNA, mas inibide a sua tradução miRNAs em animais

48 miRNAs em plantas Em plantas, miRNAs são 100% (ou quase) complementares ao mRNA alvo Um tipo de miRNA tem somente um ou poucos mRNAs alvos A ligação do miRNA ao mRNA alvo leva à degradação do mRNA, da mesma forma que o siRNA

49 Exemplos de miRNA em Arabidopsis Llave et al., Plant Cell 14:1605, 2002

50 Detecção do miRNA-5 em Arabidopsis Llave et al., Plant Cell 14:1605, 2002

51 Comparação de construções para desencadeamento de silenciamento gênico

52 Vetor para expressão de mRNA em hairpin Varsha Wesley et al., 2001

53


Carregar ppt "Desenvolvimento de construções gênicas para a transformação de plantas Ricardo Harakava Pesquisador Científico Laboratório de Bioquímica Fitopatológica."

Apresentações semelhantes


Anúncios Google