A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

DNA FINGER PRINT PROF. ALEXANDRE S. OSÓRIO. VNTRs - Variable Number of Tandem Repeats Em alguns cromossomos humanos, existem certas regiões em que uma.

Apresentações semelhantes

Apresentação em tema: "DNA FINGER PRINT PROF. ALEXANDRE S. OSÓRIO. VNTRs - Variable Number of Tandem Repeats Em alguns cromossomos humanos, existem certas regiões em que uma."— Transcrição da apresentação:


2 VNTRs - Variable Number of Tandem Repeats Em alguns cromossomos humanos, existem certas regiões em que uma pequena seqüência de DNA é repetida várias vezes Seqüências hipervariáveis (também chamadas polimórficas) repetitivas de 1 a 4 pb com distribuição ao longo do genoma. O polimorfismo destas seqüências é resultado de diferentes rearranjos envolvendo segmentos de DNA de tamanhos diferentes. Herança Mendeliana (os filhos sempre recebem metade dos alelos de origem materna e metade de origem paterna).

3 Número variável de repetições em seqüência Exemplos de seqüências de VNTRs: Repetição de 1 base: GTAAAAAAAAAAAAAAAGGAT Repetição de 2 bases: GTCACACACACACACACAGGAT (dinucleotídeo) Repetição de 3 bases: GTCACCACCACCACCACCACGGAT (trinucleotídeo) Repetição de 4 bases: GTCAGACAGACAGACAGAGGAT (tetranucleotídeo)

4 IMPRESSÕES DIGITAIS DO DNA (DNA FINGERPRINTS) O QUE SIGNIFICA? Com base no estudo de uma bateria de 12-20 VNTRs, é possível obter perfis genéticos praticamente indivíduo-específicos, muito úteis na investigação de paternidade, identificação de vítimas e criminosos. TÉCNICAS RFLP (Restriction Fragment Lenght Polymorphism). PCR (Polymerase Chain Reaction).

5 Polimorfismo de Comprimento de Fragmento de Restrição 1) Coleta de amostras biológicas que podem ser saliva, sangue, esperma e cabelo com raiz, entre outros. 2) Extração e purificação do DNA. 3) Corte com enzimas de restrição (tesouras moleculares que reconhecem e cortam seqüências específicas do DNA). 4) Eletroforese: onde, através de uma corrente elétrica, são separados os fragmentos de DNA por tamanho. A partir daí, é formada uma espécie de código de barras que é a identificação individual e intransferível de cada indivíduo.

6 As enzimas de restrição Fazem parte de um sistema da célula bacteriana denominado sistema de modificação-restrição. Este sistema consiste numa endonuclease de restrição. O nome dado a enzima refere-se ao organismo de onde foi isolado. A primeira letra representa o gênero e as outras duas a espécie, seguido de um algarismo romano (ou outra letra) que indica a ordem da descoberta ou a linhagem da qual foi isolado. Sítios de reconhecimento, modificação e clivagem por alguns enzimas de restrição EnzimaLocal de restriçãoOrganismo de origem EcoRI Escherichia coli HindIII Haemophilus influenza Smal Serratia marcescens

7 Enzimas de restrição Uma enzima de restrição ou endonuclease de restrição é um tipo de nuclease que cliva uma cadeia dupla de DNA sempre que identificar uma sequência específica de 4 a 8 pares de bases que seja o local de restrição da enzima (Smith & Wilcox, 1970). As seqüências reconhecidas apresentam nas duas cadeias complementares seqüências idênticas mas invertidas – palíndromo.


9 PCR – REAÇÃO EM CADEIA DE POLIMERASE Aquecimento do DNA a ser amplificado a temperatura de 94°C por 1 minuto, o que provoca separação da dupla hélice. Depois, com a temperatura mais baixa, são empregadas as polimerases, que atuam em cada uma das cadeias do DNA, complementando os pares de bases. A cada ciclo, a quantidade de DNA-alvo é duplicada, de modo que em 10 ciclos obtêm-se 1024 vezes mais DNA-alvo; em 20 ciclos, cerca de 1 milhão de vezes mais DNA-alvo. Propicia um aumento na eficiência da análise de material genético Polimerases são enzimas que ocorrem nas células e catalisam reações de polimerização (formação de moléculas de cadeias longas) Pela técnica PCR promove-se a duplicação de trechos do DNA in vitro.

10 PCR

11 VISUALIZAÇÃO DO DNA Uso de sondas: pequenos segmentos de DNA radioativados, cuja seqüência de bases é conhecida. Acoplam-se às seqüências de DNA das quais são complementares, ligando-se às mesmas. SLP: detecta um único segmento de DNA repetitivo em um único cromossomo. Seu uso resulta em um padrão que contém no máximo duas bandas: uma para cada segmento de DNA reconhecido em cada membro do par de cromossomos homólogos. Para a obtenção de padrões mais característicos de cada pessoa, são necessárias várias sondas. Devido à sua sensibilidade, são empregadas nas investigações criminais.

12 SLP (single-locus probe)

13 VISUALIZAÇÃO DO DNA MLP: detecta vários segmentos de DNA repetitivo localizados em muitos cromossomos. O padrão obtido consiste em aproximadamente 20 a 30 bandas. Por isso, a probabilidade de duas pessoas tomadas ao acaso apresentarem todas as bandas exatamente com a mesma posição é extremamente baixa (1:10 trilhões).

14 MLP (multi-locus-probe)







21 RESULTADOS DE TESTES Mary Higgins foi violentada no Central Park em Nova York. Três suspeitos foram presos. O DNA revelou o verdadeiro agressor.

22 Mais de uma década após o assassinato da modelo infantil JonBenet Ramsey, o caso ainda parece inacabado e apoiado apenas em suposições - mesmo após o professor John Mark Karr, de 41 anos, ter confessado que estava com a menor no momento de sua morte, assegurando que foi um acidente e que estava apaixonado por ela. JonBenet Ramsey, de 6 anos, foi encontrada morta a pancadas e estrangulada no porão de sua casa, em Boulder, no dia 26 de dezembro de 1996, num crime que comoveu a sociedade americana. A menina era uma das modelos infantis mais famosas nos Estados Unidos. John Mark Karr foi preso na quarta-feira, um dia depois de começar a ensinar em uma escola em Bangcoc, Tailândia, por solicitação dos Estados Unidos. Após o crime, em 1996, os pais de JonBenet, John e Patsy Ramsey, viveram sob as suspeitas levantadas por tablóides sensacionalistas, que sugeriam que os dois maltratavam e exploravam a menina com suas aparições em desfiles infantis. Além disso, John e Patsy eram acusados de terem ocultado informações cruciais para a investigação do caso.

23 RESULTADOS DE TESTES O assassinato de JonBenet Ramsey: um crime sem solução? Tristeza ou remorso ?

24 RESULTADOS DE TESTES Em 1987: casal de noivos – Matthew Brock e Kelly Lynn Perry (também estuprada) – é achado baleado na cabeça (bala de rifle calibre 30) em Rodman Dam, área de recreação na Flórida. Principais suspeitos: os adolescentes Randall Scott Jones e Chris Reesh.

25 RESULTADOS DE TESTES Em agosto, Jones foi preso dirigindo a camionete roubada no Mississippi. Reesh foi preso no dia seguinte em Palatka, na Flórida. Como os jovens insistiam em negar a participação no crime e ainda existiam algumas dúvidas sobre o caso, existia a necessidade de se conseguir mais provas. Sendo assim, foi realizado pela primeira vez o DNA fingerprinting para um caso criminal. A amostra de sêmen encontrada em Kelly foi comparada com as amostras de sangue dos supeitos. Com os resultados do DNA fingerprinting o juri não hesitou em condenar Jones e Reesh.


Carregar ppt "DNA FINGER PRINT PROF. ALEXANDRE S. OSÓRIO. VNTRs - Variable Number of Tandem Repeats Em alguns cromossomos humanos, existem certas regiões em que uma."

Apresentações semelhantes

Anúncios Google