A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Produção de Proteínas Recombinantes. O que são proteínas recombinantes? São proteínas produzidas artificialmente a partir de genes clonados. Isto é, advêm.

Apresentações semelhantes


Apresentação em tema: "Produção de Proteínas Recombinantes. O que são proteínas recombinantes? São proteínas produzidas artificialmente a partir de genes clonados. Isto é, advêm."— Transcrição da apresentação:

1 Produção de Proteínas Recombinantes

2 O que são proteínas recombinantes? São proteínas produzidas artificialmente a partir de genes clonados. Isto é, advêm da técnica de DNA recombinante. Para que servem? A produção de proteínas recombinantes permite obter benefícios em várias áreas: - saúde; - biologia; - bioquímica; - microbiologia; - genética; - biotecnologia; - agricultura; - etc.

3 Terapia gênica Possibilidade de introdução de um gene num organismo e consequente correção de doenças genéticas. Melhoramento animal e vegetal Plantas resistentes a pragas e a diferentes meios nutritivos. Animais de maiores dimensões, mais férteis e carne com maior qualidade. Criação de modelos animais Ideais para o estudo da estrutura, função e regulação de um gene, além de facilitar a compreensão da fisiopatologia da doença. Algumas aplicações

4 Técnica de produção de proteínas recombinantes Isolar e preparar o DNA; Escolher o vetor apropriado; O fragmento de DNA a clonar é introduzido em vectores de clonagem, formando-se o DNA recombinante. O DNA recombinante é inserido na célula hospedeira – transformação, que possui mecanismos enzimáticos para a replicação do DNA e para a síntese protéica; Selecção e identificação de células que incorporam o DNA recombinante; Verificar se a proteína foi expressa; Remoção e purificação das proteínas. The Cell- A Molecular Approach;Cooper, Geoffrey M..

5 Algumas enzimas envolvidas no processo EnzimasFunção Tipo II (endonuclease de restrição)Cortam os DNAs em sequências de bases específicas. DNA ligaseJuntam duas moléculas de DNA ou fragmentos. Taq DNA polimeraseAdiciona os nucleotídeos na extremidade 3´ da cadeia de DNA. Transcriptase reversaProduz uma molécula de DNA através de uma molécula de RNA. Enzimas de restrição- Endonucleases Enzimas de restrição- Endonucleases Os fragmentos de DNA usados para criar moléculas recombinantes são normalmente gerados por digestão através de endonucleases de restrição ou PCR Os fragmentos de DNA usados para criar moléculas recombinantes são normalmente gerados por digestão através de endonucleases de restrição ou PCR. Conhecem pequenas sequências específicas com 4 a 6 pares de bases.. Conhecem pequenas sequências específicas com 4 a 6 pares de bases.. São designadas por três letras: EcoRI, HindIII.

6 Vetores de clonagem Capaz de transportar uma seqüência de DNA estranha dando origem a um DNA híbrido ou recombinante. Capacidade de se auto-replicar. Conter pelo menos um gene que confira resistência a antibióticos. Possuir locais de restrição únicos, polylinker. Fácil de purificar. Tipos de vectores de clonagem Plasmídeos (pBR322) Fasmídeos ou fagemídeos Cosmídeos Bacteriófagos λ YACs, BACs e PACs Livro2/C11/pbr322.html

7 Vetores de expressão Promotor Códon de iniciação seguido de polylinker Local de ligação ao ribossoma Promotor Local de ligação ao ribossoma Sítio de clonagem e sequência codificante de 6 histidinas

8 Vetores para clonagem gênica

9 O que precisa um vetor para servir de molécula carreadora? A escolha de um vetor depende do design do experimento e de como o gene/proteína clonados serão pesquisados posteriormente Alguns vetores contêm uma origem procariótica de replicação o qual permite sua manutenção em bactérias.

10 Alguns vetores contêm uma origem eucariótica de replicação permitindo replicação autônoma e epissomal em células eucarióticas. Sítios de clonagem múltiplos são geralmente incluídos para versatilidade e construção de bibliotecas genômicas.

11 Genes de resistência a antibióticos e/ou marcadores selecionados permitem a identificação de células que adquiriram o vetor. Alguns vetores possuem promotores induíveis ou tecido-específicos que permitem a expressão controlada dos genes introduzidos em células transfectadas ou animais transgênicos.

12 Vetores mais modernos possuem elementos multi-funcionais que permitem uma combinação de clonagem, seqüenciamento de DNA transcrição e replicação epissomal.

13 Muitos tipos de vetores Plasmídeos, bacteriófagos, cosmídeos, cromossomo artificial bacteriano (BAC), cromossomo artificial de fungos (YAC), retrovírus, vetor de baculovírus...

14 Escolha do vetor Depende da natureza e do protocolo de experimento Tipo de célula que vai receber o vetor Procariótica Eucariótica

15 Vetor de Plasmídeo Fechado, circular, DNA dupla fita, ocorre naturalmente em bactérias e replica extracromossomalmente Muitos conferem resistência a drogas para cepas bacterianas Origem de replicação presente (ORI)

16 Examplos pBR322 Um dos primeiros plasmídeos utilizados Dois marcadores (resistência a Amp and Tet) Vários sítios de restrição espalhados através do plasmídeo ColE1 ORI

17 pUC18 Derivado do pBR322 Vantagens sobre pBR322: Pode acomodar fragmentos de DNA maiores durante a clonagem (5-10kbp) MAior número de cópias por célula (500 per cell = 5-10x mais que pBR322) Múltiplos sítios de clonagem = polylinker

18 Esquema geral de clonagem O vetor e o gene a ser clonado são purificados separadamente e depois ligados entre si Produtos ligados são introduzidos em células competentes por técnicas de transformação. As colônias são analizadas individualmente.

19 Os vetores que vêm de bactérias que sobreviveram à seleção por antibióticos são amplificados em outras bactérias O plasmídeo contendo DNA é purificado em larga escala

20 F. Vetores cosmídeos Moléculas híbridas contendo DNA de plasmídeos e de bacteriófagos lambaLambda components: COS sequences (required for in vitro packaging into phage coats) Componentes do plasmídeo: ORI + Gene de resistência aos antibióticos Os sítios de clonagem vêm do lambda

21 F. Vetores cosmídeos

22 Após a transformação da bactéria, o rDNA replica como plasmídeo. Insertos bem grandes podem ser acomodados por cosmídeos (mais de kbp)

23 Bacterial artificial chromosomes (BACs) Pode acomodar mais de 1 Mb de DNA (= 1000kbp) Vários componentes de replicação e de controle de número de cópias estão presentes Marcadores e sítios de clonagem em diferentes lugares Outras características: Prmotores SP6 and T7 Síntese de RNA mais eficiente Sondas de RNA para hibridização

24 Bacterial artificial chromosomes (BACs)

25 I. Yeast artificial chromosomes (YACs) Molécula híbrida contendo componentes de fungos, protozoários e bactérias (plasmídeos) ORI = ARS (autonomously replicating sequence) MArcadores (TRP1 and URA3) Centrômero de fungos Protozoa= Tetrahymena Sequências de telômeros Plasmídeos bacterianos Polylinker Pode acomodar >1Mb (1000kbp = 10 6 bp)

26 I. Yeast artificial chromosomes (YACs)

27

28 Human artificial chromosomes Devenvolvidos em 1997 – sintéticos, auto- replicantes 1/10 do tamanho de um cromossomo normal Microcromossomo que passa para as células durante a mitose Contém: ORI Centrômero Telômero Cap protetor de DNA repetitivo no fim do cromossomo Histonas dadas pela célula hospedeira

29 J. Human artificial chromosomes

30 Transformação Ocorre quando uma célula incorpora e exprime um fragmento de material genético. Para a introdução do DNA recombinante podem ser utilizados vários métodos: Células competentes; Eletroporação; Bombardeamento de DNA revestido de Tungsténio; Microinjeção; Transfecção. Modern Genetic AnalysisModern Genetic Analysis.

31 Extracção e purificação de proteínas Extração lise celular Purificação Cromatografia de afinidade Lehningher Principles of Biochemistry

32 Tags moleculares de fusão Fusion TagImmobilized Ligand Binding ConditionsElution ConditionsAvailable Formats Glutathione (S- transferase(GS T) Reduced glutathioneNeutral (physiologic) pH, and non-denaturing; glutathione must be reduced and GST must be active Free reduced glutathione at neutral pH (competitor) Prepacked column kits, spin cup column kits, SwellGel Discs, coated microplates Histidine-taggedChelated Nickel or Cobalt Neutral (physiologic) pH without reducing or oxidizing agents; small tag must be accessible in fusion protein structure; high ionic strength and denaturants (chaotropes such as 8 M urea) compatible. >200 mM Imidazole, low pH, or strong chelators Prepacked column kits, spin cup column kits, SwellGel Discs, Swell- Gel Discs in 96-well filter plates, coated microplates Maltose Binding Protein (MBP) DextrinNeutral (physiologic) pH and non-denaturing; NaCl added to reduce nonspecific binding Maltose at neutral pH (competitor) Gel slurry, coated microplates Green Fluorescent Protein (GFP) Anti-GFP antibodyNeutral (physiologic) pH and non-denaturing Usual antibody/antigen elution buffers (e.g., low pH or chaotropic salts) Coated microplates

33 Exemplos de Proteínas Recombinantes Hormônio de crescimento humano – a administração deste hormônio durante a infância permite a correção dos casos de nanismo. Anticoagulantes – ativadores de plasminogênio tecidual que por sua vez ativam a plasmina, enzima que dissolve os trombos (evita ataques cardíacos). Dismatase do superóxido – previne danificação de tecidos quando este é exposto à falta de oxigênio. Anticorpos monoclonais – são usados em testes diagnósticos; transporte direccionado (drogas, toxinas, componentes radioactivos utilizados na terapia cancerígena), assim como outras aplicações. ioh.medstudents.com.br/ humoral.htm

34 Referência cronológica Frederick Grant Banting descobre a insulina É produzida insulina humana recombinante Esta insulina é disponibilizada no mercado. Insulina

35 - Duas cadeias peptídicas- cadeia A e cadeia B. - Duas pontes dissulfeto entre as cadeias A e B e outra na própria cadeia A.

36 Insulina recombinante Monômeros- Insulina é ativa na forma de monômeros. Dímeros – pontes de hidrogênio entre as extremidades C da cadeia B. Zn 2+

37 Produção de insulina Insulina proveniente de suínos e bovinos Insulina humana biossintética Introduction to Genetic Analysis.

38 Β-gal Β-gal peptide Purify β-gal- insulin fusion proteins

39 SAGSeqüênciaReferência SAG1Forward: CGGAATTCATGTCGGTTTCGCTGCACCAC Reverse: CCCAAGCTTCACTCACGCGACACAAGCTG Burg et al, 1988 SAG2Forward: GCGGATCCATGAGTTTCTCAAAGACCACG Reverse: GGGAATTCTTACACAAACGTGATCAACAA Parmley et al, 1992 SAG3Forward: GAGGATCCATGCAGCTGTGGCGGCGCAG Reverse: GGGAATTCTTAGGCAGCCACATGCACAA Cebron-Delauw, 1994

40

41 A- SAG1 – CEPA RH 5`ATGTCGGTTTCGCTGCACCACTTCATTATTTCTTCTGGTTTTTTGACGAGTATGTTTCCGAAGGCAGTGAGACGCGCCGTCACGGCAG GGGTGTTTGCCGCGCCCACACTGATGTCGTTCTTGCGATGTGGCGTTATGGCATCGGATCCCCCTCTTGTTGCCAATCAAGTTGTCACC TGCCCAGATAAAAAATCGACAGCCGCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCAAGTGCCCTAAAACAGCGCTCACA GAGCCTCCCACTCTTGCGTACTCACCCAACAGGCAAATCTGCCCAGCGGGTACTACAAGTAGCTGTACATCAACGGCTGTAACATTGA GCTCCTTGATTCCTGAAGCAGAAGATAGCTGGTGGACGGGGGATTCTGCTAGTCTCGACACGGCAGGCATCAAACTCACAGTTCCAA TCGAGAAGTTCCCCGTGACAACGCAGACGTTTGTGGTCGGTTGCATCAAGGGAGACGACGCACAGAGTTGTATGGTCACGGTGACAG TACAAGCCAGAGCCTCATCGGTCGTCAATAATGTCGCAAGGTGCTCCTACGGTGCAGACAGCACTCTTGGTCCTGTCAAGTTGTCTGC GGAAGGACCCACTACAATGACCCTCGTGTGCGGGAAAGATGGAGTCAAAGTTCCTCAAGACAACAATCAGTACTGTTCCGGGACGAC GCTGACTGGTTGCAACGAGAAATCGTTCAAAGATATTTTGCCAAAATTAACTGAGAACCCGTGGCAGGGTAACGCTTCGAGTGATAAG GGTGCCACGCTAATGATCAAGAAGGAAGCATTTCCAGCCGAGTCAAAAAGCGTCATTATTGGATGCACAGGGGGATCGCCTGAGAAG CATCACTGTACCGTGAAACTGGAGTTTGCCGGGGCTGCAGGGTCAGCAAAATCGGCTGCGGGAACAGCCAGTCACGTTTCCATTTTT GCCATGGTGATCGGACTTATTGGCTCTATCGCAGCTTGTGTCGCGTGA 3` B- SAG2 – CEPA RH 5´ATGAGTTTCTCAAAGACCACGAGCCTAGCGTCGCTAGCGCTCACGGGCTTGTTTGTTGTGTTCAAGTTCGCTCTTGCGTCCACCACC GAGACGCCAGCACCCATTGAGTGCACTGCCGGCGCAACGAAGACTGTTGATGCACCCTCCAGTGGTTCCGTTGTCTTCCGATGTGGG GATAAACTAACCATCAGTCCCAGTGGCGAAGGTGATGTCTTTTATGGCAAGGAATGCACAGACTCGAGGAAGTTGACGACTGTCCTTC CAGGTGCGGTCTTGGCAGCTAAGGTCGAGCAGCCCCCGAAAGGTCCTGCTACCTACACACTGTCTTACGACGGTACTCCCGAGAAAC CTCAGGTTCTCTGTTACAAGTGCGTTGCCGAAGCAGGTGCTCCCGCTGGTCGAAATAATGATGGTGGTTCTAGCGCTCCGACGCCTAA AGACTGCAAACTCATTGTTCGCGTTCCGGGTGCCGATGGCCGTGTCACATCTGGGTTTGACCCTGTGTCTCTCACGGGCAAGGTTCTT GCTCCCGGTCTCGCAGGTTTGTTGATCACGTTTGTGTAA 3` C- SAG3 – cepa rh 5´ATGCAGCTGTGGCGGCGCAGAGCAGCAGGTCCCGCGAGCCTGGGGAGGCAGTCTTTGCCGCTCGGGTGTTTTTTCGCGGCTTTTGG TTTGTGCGTGTTGTCTGCGATCTTGGGAACCGGAGAGCACGGACTGTTCGTCGCCGCAGGGAAATCGAGAAGTAAGATAACCTATTTT GGCACGCTCCTCAAGAAGGCTCCGAACTGGTACCGCTGCTCTTCAACGAGGGCGAATGAAGAGGTCGTAGGACATGTGACGCTGAA CAAAGAGCACCCTGATATGACAATTGAATGCGTCGACGACGGCTTGGGCGGAGAGTTTTTGCCGCTCGAAGGCGGCACGTCGTCGTA CCCGCGAGTATGTCACATTGATGCCAAGGACAAGGGCGACTGCGAGCGCAACAAGGGCTTTCTGACCGACTACATACCGGGCGCGA ACAGGTACTGGTACAAGATAGAAAAGGTGGAGAACAACGGCGAGCAATCCGTTCTGTACAAATTCACAGTTCCTTGGATATTCCTTCC GCCCGCCAAGCAGCGATACAAGGTTGGATGCCGATACCCGAACCACGAGTATTGCTTTGTTGAGGTCACCGTCGAACCCACGCCGCC AATGGTCGAAGGCAAGAGAGTGACCTGCGGGTATCCCGAGTCCGGCCCCGTGAATCTCGAGGTGGACTTGTCAAAGGACGCGAACT TTATCGAGATTCGGTGCGGCGAACAGCACCACCCGCAGCCGTCGACCTACACGCTGCAGTACTGCTCAGGTGACTCGGTGGACCCGC AGAAGTGTTCGCCGCAGTCCCTGACGAACATTTTTTATGACTACAGCTCTTCGTGGTGGAAGGGGAAACTGAACGGGCCTGACGGGG CAACTCTCACCATTCCACCCGGCGGGTTCCCCGAAGAAGACAAATCTTTTCTTGTCGGGTGTTCACTCACTGTGGACGGGCCGCCCTT CTGCAACGTCAAAGTGAGAGTTGCCGGGAACCCCAGAAAGTGGGGGAGAGGCGGAGGCGGCCATCCAGGAAGCGGAGGATTGCAG CCGGGAACTGAAGGGGAAAGTCAAGCTGGAACAGAAAGTTCAGCCGGCGCGAGTTCGCGAATGGCTTCCGTTGCCCTGGCGTTCCTT CTCGGTCTCCTTGTGCATGTGGCTGCCTAA 3´

42

43

44 A - SAG1 M S V S L H H F I I S S G F L T S M F P K A V R R A V T A G V F A A P T L M S F L R C G V M A S D P P L V A N Q V V T C P D K K S T A A V I L T P T E N H F T L K C P K T A L T E P P T L A Y S P N R Q I C P A G T T S S C T S K A V T L S S L I P E A E D S W W T G D S A S L D T A G I K L T V P I E K F P V T T Q T F V V G C I K G D D A Q S C M V T V T V Q A R A S S V V N N V A R C S Y G A D S T L G P V K L S A E G P T T M T L V C G K D G V K V P Q D N N Q Y C S G T T L T G C N E K S F K D I L P K L T E N P W Q G N A S S D K G A T L T I K K E A F P A E S K S V I I G C T G G S P E K H H C T V K L E F A G A A G S A K S A A G T A S H V S I F A M V I G L I G S I A A C V A B - SAG2 M S F S K T T S L A S L A L T G L F V V F K F A L A S T T E T P A P I E C T A G A T K T V D A P S S G S V V F R C G D K L T I S P S G E G D V F Y G K E C T D S R K L T T V L P G A V L A A K V E Q P P K G P A T Y T L S Y D G T P E K P Q V L C Y K C V A E A G A P A G R N N D G G S S A P T P K D C K L I V R V P G A D G R V T S G F D P V S L T G K V L A P G L A G L L I T F V C - SAG3 M Q L W R R R A A G P A S L G R Q S L P L G C F F A A F G L C V L S A I L G T G E H G L F V A A G K S R S K I T Y F G T L L K K A P N W Y R C S S T R A N E E V V G H V T L N K E H P D M T I E C V D D G L G G E F L P L E G G T S S Y P R V C H I D A K D K G D C E R N K G F L T D Y I P G A N R Y W Y K I E K V E N N G E Q S V L Y K F T V P W I F L P P A K Q R Y K V G C R Y P N H E Y C F V E V T V E P T P P M V E G K R V T C G Y P E S G P V N L E V D L S K D A N F I E I R C G E Q H H P Q P S T Y T L Q Y C S G D S V D P Q K C S P Q S L T N I F Y D Y S S S W W K G K L N G P D G A T L T I P P G G F P E E D K S F L V G C S L T V D G P P F C N V K V R V A G N P R K W G R G G G G H P G S G G L Q P G T E G E S Q A G T E S S A G A S S R M A S V A L A F L L G L L V H V A A

45

46

47


Carregar ppt "Produção de Proteínas Recombinantes. O que são proteínas recombinantes? São proteínas produzidas artificialmente a partir de genes clonados. Isto é, advêm."

Apresentações semelhantes


Anúncios Google