A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

Seqüenciamento parcial de transcritos. Seqüênciamento de genes expressos: Documentar a existência de transcritos gênicos num transcriptoma [otorrin...

Apresentações semelhantes


Apresentação em tema: "Seqüenciamento parcial de transcritos. Seqüênciamento de genes expressos: Documentar a existência de transcritos gênicos num transcriptoma [otorrin..."— Transcrição da apresentação:

1 Seqüenciamento parcial de transcritos

2 Seqüênciamento de genes expressos: Documentar a existência de transcritos gênicos num transcriptoma [otorrin... e...damonh...] EST (Etiqueta de Seqüência Expressa) – –seqüenciamento único de cada cDNA – –extremidades 5 ou 3 ORESTES (ESTs ricas em ORFs) – –seqüenciamento único do amplicon derivado de cDNA por PCR inespecífico – –prevalece o centro do cDNA (cds)

3 (A) 20 0 AUG Um mRNA & suas ESTs (A) 20 0 (T) 18 cDNA (fita -) AUG (A) 18 cDNA (fita +) (T) 18 cDNA (fita -) (A) 18 ATG ATCATGACTTACGGGCGCGCGAT GGCGCGCGATATCC A A A T T T A T T A T C C 3EST 5EST A A A T T T A T T A T C C A T C T A C G

4 PCR inespecífico & seu ORESTES (A) 200 cDNA (fita -) AUG amplicon (fita +) Iniciador (60ºC 37ºC) amplicon (fita -) amplicon (fita +) PCR (60ºC) ORESTES AGATCGATCATGACTTACGGGCGCGCGATATCG GGGCGCGCGATATCGAAAAATTTATAAGGCTAG CCCCGGCGGCTCGGCCGGGGAGATCGATCATGAC +ORESTES (outros iniciadores)


Carregar ppt "Seqüenciamento parcial de transcritos. Seqüênciamento de genes expressos: Documentar a existência de transcritos gênicos num transcriptoma [otorrin..."

Apresentações semelhantes


Anúncios Google