A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

ICB –USP Disciplina: Bioinformática Aplicada ao Estudo de Doenças Parasitárias Jaques Franco Plataforma SOLiD.

Apresentações semelhantes

Apresentação em tema: "ICB –USP Disciplina: Bioinformática Aplicada ao Estudo de Doenças Parasitárias Jaques Franco Plataforma SOLiD."— Transcrição da apresentação:

1 ICB –USP Disciplina: Bioinformática Aplicada ao Estudo de Doenças Parasitárias Jaques Franco Plataforma SOLiD

2 Carvalho et al,2010

3 Andreonte,2011.

4 Base -code Color-code ATGTCGTGCTGCCGAGCGGAGGTGAATGAGCCAGTAACTCCCAGC TCCGCTTCATCATTGGAGTCTGACG T012301123321023021123021 001232332 ABI-SOLiDIllumina-SolexaRoche-454 c c


6 SOLiD 4 SOLiD 5500

7 Reação é catalisada por uma DNA ligase

8 Nesse método os fragmentos de DNA são gerados e ligados aos adaptadores P1 e P2 que se ligam especificamente a uma microesfera


10 Ciclo de hibridização a cada 35pb


12 Saída do Sequenciador Os arquivos que representam as sequências obtidas estão no formatocsfasta. Valor da qualidade associada a cada transição de base das sequências lidas estão no formato qual.

13 Pipeline De novo É um conjunto de softwares utilizados para montagens de genomas onde não se conhece a referência, ele faz a montagem dos reads e gera sequências maiores como contigs e scaffolds.

14 Limitações 1.Leituras curtas de 35 pares de bases 2. Regiões repetitivas 3. Construção de bibliotecas 4. Custo das máquinas 5. Erros de montagem 6. Processamento, análise e interpretação de dados 8. DNA barcode

Carregar ppt "ICB –USP Disciplina: Bioinformática Aplicada ao Estudo de Doenças Parasitárias Jaques Franco Plataforma SOLiD."

Apresentações semelhantes

Anúncios Google