A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

CAP3 Aula de algoritmo: CAP3 Felipe Rodrigues da Silva Embrapa Recursos Genéticos e Biotecnologia.

Apresentações semelhantes


Apresentação em tema: "CAP3 Aula de algoritmo: CAP3 Felipe Rodrigues da Silva Embrapa Recursos Genéticos e Biotecnologia."— Transcrição da apresentação:

1 CAP3 Aula de algoritmo: CAP3 Felipe Rodrigues da Silva Embrapa Recursos Genéticos e Biotecnologia

2 CAP3 Seqüenciamento

3 CAP3 Polimerização de DNA ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||||||||||||||||||||||||||||

4 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||| 53 ATGCTTC 53 A A A A A A A A A A T T T T T T T T T T TGG G G G G G G G C C C C C C C C C C C

5 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||| 53 ATGCTTC 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

6 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||| 53 ATGCTTCTG 53A A A A AA A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

7 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||||| 53 ATGCTTCTGGCAGATCT 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

8 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||||| 53 ATGCTTCTGGCAGATCT 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

9 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||| 53 ATGCTTCTGGCAGATCTGAACA 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

10 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||| 53 ATGCTTCTGGCAGATCTGAACAGTGTT 53A A A A A A A A A A T T T T T T T T TT T G G G G GG G G G C C C C C C C C C C C

11 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||||||||| 53 ATGCTTCTGGCAGATCTGAACAGTGTTACTG 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

12 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||||||||| 53 ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT 53A A A A A A A A A A T T T T T T T T T T T G G G G GG G G G C C C C C C C C C C C

13 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||||||||| 53 ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G CC C C C C C C C C C

14 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||||||||||||||||||||||||||| 53 ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT 53A A A A A A A A A A T T T T T T T T T T T G G G G GG G G G CC C C C C C C C C C

15 CAP3 Polimerização de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||||||||||||||||||| 53 ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT 53A A A A A A A A A A T T T T T T T T T T T G G G G GG G G G CC C C C C C C C C C

16 CAP Walter Gilbert e Frederick Sanger seqüenciamento de DNA

17 CAP3 Dideoxinucleotídeo dideoxinucleotídeo O - O-P-P-P-O-CH 2 - O - OOO BASE - O - - O - H 3'2' H O - O-P-P-P-O-CH 2 - O - OOO BASE - O - - O - H 3'2' H

18 CAP3 Seqüenciamento de DNA

19 CAP3 Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||| 53 ATGCTTC 53 A A A A A A A A A A T T T T T T T T T T TGG G G G G G G G C C C C C C C C C C C

20 CAP3 Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||| 53 ATGCTTC 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

21 CAP3 Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||| 53 ATGCTTCTG 53A A A A AA A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

22 CAP3 Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||||| 53 ATGCTTCTGGCAGATCT 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

23 CAP3 Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||||| 53 ATGCTTCTGGCAGATCT 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

24 CAP3 Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||| 53 ATGCTTCTGGCAGAT 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

25 CAP3 Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||| 53 ATGCTTCTGGCAGAT 53A A A A A A A A A A T T T T T T T T TT T G G G G GG G G G C C C C C C C C C C C

26 CAP3 Polimerização de DNA o dideoxi TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA ||||||||||||||| 53 ATGCTTCTGGCAGAT 53A A A A A A A A A A T T T T T T T T T T T G G G G G G G G G C C C C C C C C C C C

27 CAP3 Seqüenciamento de DNA TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||||||||||||||||||| 53 ATGCTTCTGGCAGAT ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT 53 ATGCTTCTGGCAGATCTGAACAGTGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATAT ATGCTTCTGGCAGATCTGAACAGTGTTACT ATGCTTCTGGCAGATCTGAACAGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATT ATGCTTCT ATGCTTCTGGCAGATCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTT

28 CAP3 Seqüenciamento de DNA ATGCTTCTGGCAGAT ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT ATGCTTCTGGCAGATCTGAACAGTGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATAT ATGCTTCTGGCAGATCTGAACAGTGTTACT ATGCTTCTGGCAGATCTGAACAGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATT ATGCTTCT ATGCTTCTGGCAGATCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTT TACGAAGACCGTCTAGACTTGTCACAATGACTATAACGAA |||||||||||||||||||||||||||||||||||||||| 53

29 CAP3 Seqüenciamento de DNA ATGCTTCTGGCAGAT ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT ATGCTTCTGGCAGATCTGAACAGTGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATAT ATGCTTCTGGCAGATCTGAACAGTGTTACT ATGCTTCTGGCAGATCTGAACAGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATT ATGCTTCT ATGCTTCTGGCAGATCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTT

30 CAP3 Seqüenciamento de DNA GATC molde molde polimerase polimerase dNTPs dNTPs ddGTPsddGTPs ddATPsddATPs ddTTPsddTTPs ddCTPsddCTPs

31 CAP3 Seqüenciamento de DNA ATGCTTCTGGCAGAT ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT ATGCTTCTGGCAGATCTGAACAGTGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATAT ATGCTTCTGGCAGATCTGAACAGTGTTACT ATGCTTCTGGCAGATCTGAACAGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATT ATGCTTCT ATGCTTCTGGCAGATCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTT ATGCTTCTG ATGCTTCTGG ATGCTTCTGGCAG ATGCTTCTGGCAGATCTG ATGCTTCTGGCAGATCTGAACAG ATGCTTCTGGCAGATCTGAACAGTG ATGCTTCTGGCAGATCTGAACAGTGTTACTG ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTG ATGCTTCTGGC ATGCTTCTGGCAGATC ATGCTTCTGGCAGATCTGAAC ATGCTTCTGGCAGATCTGAACAGTGTTAC ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGC ATGCTTCTGGCA ATGCTTCTGGCAGA ATGCTTCTGGCAGATCTGA ATGCTTCTGGCAGATCTGAA ATGCTTCTGGCAGATCTGAACA ATGCTTCTGGCAGATCTGAACAGTGTTA ATGCTTCTGGCAGATCTGAACAGTGTTACTGA ATGCTTCTGGCAGATCTGAACAGTGTTACTGATA GATC

32 CAP3 Seqüenciamento de DNA ATGCTTCTGGCAGAT ATGCTTCTGGCAGATCTGAACAGTGTTACTGAT ATGCTTCTGGCAGATCTGAACAGTGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATAT ATGCTTCTGGCAGATCTGAACAGTGTTACT ATGCTTCTGGCAGATCTGAACAGT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATT ATGCTTCT ATGCTTCTGGCAGATCT ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGCTT ATGCTTCTGGCAGATCTGAACAGTGTT ATGCTTCTG ATGCTTCTGG ATGCTTCTGGCAG ATGCTTCTGGCAGATCTG ATGCTTCTGGCAGATCTGAACAG ATGCTTCTGGCAGATCTGAACAGTG ATGCTTCTGGCAGATCTGAACAGTGTTACTG ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTG ATGCTTCTGGC ATGCTTCTGGCAGATC ATGCTTCTGGCAGATCTGAAC ATGCTTCTGGCAGATCTGAACAGTGTTAC ATGCTTCTGGCAGATCTGAACAGTGTTACTGATATTGC ATGCTTCTGGCA ATGCTTCTGGCAGA ATGCTTCTGGCAGATCTGA ATGCTTCTGGCAGATCTGAA ATGCTTCTGGCAGATCTGAACA ATGCTTCTGGCAGATCTGAACAGTGTTA ATGCTTCTGGCAGATCTGAACAGTGTTACTGA ATGCTTCTGGCAGATCTGAACAGTGTTACTGATA

33 CAP3

34

35

36

37 Gel inteiro

38 CAP3 Gel e cromatograma

39 CAP3

40 Seqüenciamento de DNA

41 CAP3 Montagem

42 CAP3 Shotgun Amostrar fragmentos da seqüência-alvo da maneira mais aleatória possível. Determinar a maior porção possível das seqüências das extremidades destes fragmentos Sanger F, Coulson AR, Hong GF, Hill DF, Petersen GB. (1982) Nucleotide sequence of bacteriophage lambda DNA. J Mol Biol 162(4):

43 CAP3 Montagem shotgun DNA original

44 CAP3 Maior problema computacional Determinar a disposição das seqüências dos fragmentos que seja mais consistente com as sobreposições encontradas Este é um problema NP-completo!

45 CAP3 Para complicar... 1.Há uma certa porcentagem de erros nas leituras 2.A leitura pode ser proveniente de qualquer uma das duas fitas 3.Há desvio de representatividade 4.Existem falsas sobreposições

46 CAP3 Um programa para montagem de seqüências de DNA Xiaoqiu Huang 1 and Anup Madan 2 1 Department of Computer Science, Michigan Technological University, Houghton, Michigan; 2 Department of Molecular Biotechnology, University of Washington, School of Medicine, Seattle, Washington Genome Research 9:

47 CAP3 Três fases do algoritmo de montagem Remoção das extremidades de baixa qualidade Cálculo de sobreposição de reads Remoção das falsas sobreposições Construção dos contigs Alinhamento múltiplo e geração do consenso

48 CAP3 Três fases do algoritmo de montagem Remoção das extremidades de baixa qualidade Cálculo de sobreposição de reads Remoção das falsas sobreposições Construção dos contigs Alinhamento múltiplo e geração do consenso

49 CAP3 Identificação de sobreposição Concatena todos os reads Encontram-se segmentos de alta pontuação –Caracter separador Busca binária na lista ordenada de posição dos reads na seqüência combinada Não são analisadas porções anteriores ao read atual

50 CAP3 Cálculo das posições de corte de read corte 5 corte 3 Read h Read f Read g

51 CAP3 Smith-Waterman ponderado Match = m * min(q1,q2) Mismatch = n * min(q1,q2) Gap = -q * min(q1,q2)

52 CAP3 Cálculo da sobreposição de reads

53 CAP3 Cálculo da sobreposição de reads Feito por alinhamento global Banda de busca 2x maior que no alinhamento local Avaliação –comprimento –identidade –pontuação de similaridade –HQDs (max [0, min(q1, q2)-b], d=soma –taxa de discrepância (r1+r2+e)

54 CAP3 Uso de limitadores (constraints) 1.Layout preeliminar 2.Checagem de qualidade 3.Corrige os ruins com mais que u problemas 4.Liga contigs com mais que v limitações satisfeitas

55 CAP3 Uso de limitadores (constraints)

56 CAP3 Alinhamento e consenso Alinha, em ordem crescente de posição, read com o consenso já montado Soma ponderada de qualidade –base consenso = maior soma –qualidade consenso = soma base w – soma base x – soma base y...

57 CAP3 Qualidade Média

58 CAP3 Cálculo de pontuação

59 CAP3 Resultados do CAP3 Data set GenBank accession no. No. of reads Average length of reads Length of provided sequence Running time (min) No. of large contigs Length of CAP3 sequence No. of differences 203 AC , , AC , , F16 AF , , N18 AF , ,128 10

60 CAP3 Construção de Scaffolds Data set Length of answer sequence No. of reads per kb Ability to make scaffold with CAP3 Ability to make scaffold with PHRAP 188A7112, yes 201G24184, yes 213L3135, yes 257P13184, yes 488C13187, yes 501I4231, yesno

61 CAP3 Program Data setLongest Contig# large contigslength of gapsinternal errors CAP33XA , PHRAP3XA , CAP33XB12, ,76171 PHRAP3XB13, , CAP33XC10, , PHRAP3XC11, , CAP33XD11, , PHRAP3XD11, , CAP35XA10, , PHRAP5XA18, , CAP35XB26, , PHRAP5XB33,693187, CAP35XC20, , PHRAP5XC20, , CAP35XD14, ,63546 PHRAP5XD14, , CAP38XA71,025124,68183 PHRAP8XA71,39581,06180 CAP38XB53, PHRAP8XB53, CAP38XC52, PHRAP8XC76, CAP38XD72,69071,24135 PHRAP8XD102, CAP310XA91, PHRAP10XA91, CAP310XB167, PHRAP10XB138, CAP310XC106, PHRAP10XC77, CAP310XD79, PHRAP10XD79,

62 CAP3 Excelente revisão de montadores


Carregar ppt "CAP3 Aula de algoritmo: CAP3 Felipe Rodrigues da Silva Embrapa Recursos Genéticos e Biotecnologia."

Apresentações semelhantes


Anúncios Google